/dports/science/py-DendroPy/DendroPy-4.4.0/tests/data/chars/ |
H A D | standard-test-chars-dna.multi.nexus | 28 …ACGT-}{AGT}{CGT}{AGT}{ACGT}{CT}{AT}{GT}{GT}{ACGT}{ACGT-}{GT}{ACT}{AC}{ACGT}T{GT}{AT}{ACGT}{AG}{CT}… 30 c {AG}{ACGT}A{AG}T{ACG}{AT}{CG}T{ACGT}T.{AGT}{ACT}{ACGT}{CG}G{CGT}G.{ACT}.{AT}{AT}T{CG}G{ACG}{AT… 49 …C{AGT}{CT}.C.T{ACGT-}{ACGT-}{ACGT-}{ACG}.T{ACGT}{ACT}{AGT}{ACG}{AGT}{CT}.G.A{CG}{AT}{AGT}{ACGT}A{C… 52 j T..{ACGT}CG{AT}.{ACGT-}.{CG}{ACGT-}..{CG}...{GT}{CT}.{CT}CC..T..{CGT}.{AG}{ACGT-}.{AC}{ACGT-}{… 56 …CT}{ACGT-}{ACGT}{ACGT-}{ACGT-}.G{AC}{CGT}{CG}{ACGT}C.{ACG}..{AGT}{AT}{AC}{ACGT}{ACT}.{AGT}{AC}{ACG… 61 b T{CT}{ACGT}-{CG}{ACGT-}.{CG}.{AC}{ACGT}{AGT}A{CGT}..{CGT}{ACGT-}{AG}.{AT}{ACGT}{AT}{AG}{AGT}{C… 72 n .A{ACG}{ACGT}.G{CG}{CT}{AC}{CG}{ACGT-}..{ACGT}{CT}.A{AC}{AC}{ACG}T{ACGT}{ACGT}{ACGT}.{AG}{GT}.… 82 …{CT}{CT}{AT}{AT}AC.{AG}{AGT}G{ACGT}{ACGT}{ACG}{CG}{ACGT}{ACT}{CT}.{AGT}A{ACT}.T.{CGT}{ACGT}{ACGT}T… 95 e G{CT}{ACGT}..{ACT}{AC}{AG}.-A{CG}{AC}-{ACGT}{ACGT}T-{AT}{CGT}G-GGT{GT}.C{ACGT}.G.T{ACGT}{AG}{A… 97 … {ACG}A.{AGT}AG{AGT}{CG}{ACGT}{AGT}{AC}.{ACT}{ACGT-}..{ACGT}{CGT}{ACGT}.{ACGT}.T{ACT}{GT}{ACT}.A… [all …]
|
/dports/biology/ncbi-cxx-toolkit/ncbi_cxx--25_2_0/src/objtools/readers/unit_test/alnreader_test_cases/ |
H A D | rw-848-2.aln | 2 ACGT 3 ACGT 5 ACGT 6 ACGT 8 ACGT 9 ACGT 11 ACGT 12 ACGT 14 ACGT 15 ACGT [all …]
|
/dports/biology/vcftools/vcftools-0.1.16/examples/ |
H A D | indel-stats.vcf | 3 1 15 . ACGT A . PASS . 4 1 15 . A ACGT . PASS . 5 1 18 . ACGT A . PASS . 6 1 18 . A ACGT . PASS . 7 1 25 . ACGT A . PASS . 8 1 25 . A ACGT . PASS . 10 1 27 . A ACGT . PASS . 11 1 29 . ACGT A . PASS . 12 1 29 . A ACGT . PASS . 13 1 35 . ACGT A . PASS . [all …]
|
/dports/biology/py-scikit-bio/scikit-bio-0.5.6/skbio/io/format/tests/data/ |
H A D | fasta_10_seqs | 2 ACGT 4 ACGT 10 ACGT 12 ACGT 14 ACGT 16 ACGT 18 ACGT 20 ACGT
|
H A D | fasta_invalid_after_10_seqs | 2 ACGT 4 ACGT 10 ACGT 12 ACGT 14 ACGT 16 ACGT 18 ACGT 20 ACGT
|
H A D | phylip_variable_length_ids | 2 .-ACGT 4 bb .ACGT-
|
/dports/biology/sim4/sim4.2003-09-21/ |
H A D | discrim.c | 21 int ACGT, i; in is_DNA() local 23 for (ACGT = i = 0; i < len; ++i) in is_DNA() 25 ++ACGT; in is_DNA() 26 if (10*ACGT < 9*len) /* ACGT < 90% of len */ in is_DNA()
|
/dports/biology/bcftools/bcftools-1.14/test/ |
H A D | annotate.missing-append.vcf | 9 1 800000 . ACGTACGT TCGTACGT,ACGT . . . 12 1 800100 . ACGT ACC,TCGT,AC . . .
|
H A D | annotate.missing-append.1.out | 10 1 800000 . ACGTACGT TCGTACGT,ACGT . . STR=AT0,.;INT=0,.;FLT=0.0,. 13 1 800100 . ACGT ACC,TCGT,AC . . STR=.,AT,.;INT=.,1,.;FLT=.,1.0,.
|
/dports/biology/bio-mocha/bcftools-1.14/test/ |
H A D | annotate.missing-append.vcf | 9 1 800000 . ACGTACGT TCGTACGT,ACGT . . . 12 1 800100 . ACGT ACC,TCGT,AC . . .
|
H A D | annotate.missing-append.1.out | 10 1 800000 . ACGTACGT TCGTACGT,ACGT . . STR=AT0,.;INT=0,.;FLT=0.0,. 13 1 800100 . ACGT ACC,TCGT,AC . . STR=.,AT,.;INT=.,1,.;FLT=.,1.0,.
|
/dports/biology/ncbi-cxx-toolkit/ncbi_cxx--25_2_0/src/objtools/readers/hgvs/ |
H A D | hgvs_lexer.cpp | 14 ACGT("[ACGT]"), in SHgvsLexer() 46 (ACGT) in SHgvsLexer()
|
/dports/biology/samtools/samtools-1.14/test/stat/ |
H A D | 14.rg.grp3.expected | 50 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 51 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 52 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 53 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 55 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 56 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 13.barcodes.ox.ok.expected | 93 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 105 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 117 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 129 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 131 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 143 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum… 145 # ACGT content per cycle for barcodes. Use `grep ^BCC | cut -f 2-` to extract this part. The column… 180 # ACGT content per cycle for barcodes. Use `grep ^OXC | cut -f 2-` to extract this part. The column…
|
H A D | 13.barcodes.bc.ok.expected | 93 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 105 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 117 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 129 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 131 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 143 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum… 145 # ACGT content per cycle for barcodes. Use `grep ^BCC | cut -f 2-` to extract this part. The column…
|
H A D | 11.stats.expected | 82 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 93 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 104 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 115 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 117 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 128 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 11.stats.g4.expected | 82 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 93 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 104 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 115 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 117 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 128 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 14.rg.Sample.expected | 80 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 91 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 102 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 113 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 115 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 126 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 14.rg.grp2.expected | 81 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 92 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 103 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 114 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 116 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 127 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 3.stats.large.expected | 122 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 123 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 124 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 125 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 127 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 128 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
H A D | 3.stats.expected | 161 # ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle;… 162 # ACGT content per cycle, read oriented. Use `grep ^GCT | cut -f 2-` to extract this part. The colu… 163 # ACGT content per cycle for first fragments. Use `grep ^FBC | cut -f 2-` to extract this part. The… 164 # ACGT raw counters for first fragments. Use `grep ^FTC | cut -f 2-` to extract this part. The colu… 166 # ACGT content per cycle for last fragments. Use `grep ^LBC | cut -f 2-` to extract this part. The … 167 # ACGT raw counters for last fragments. Use `grep ^LTC | cut -f 2-` to extract this part. The colum…
|
/dports/biology/emboss/EMBOSS-6.6.0/emboss/data/ |
H A D | Ebases.iub | 12 N 15 ACGT any_base 19 X 15 ACGT unknown
|
/dports/biology/gmap/gmap-2020-09-12/util/ |
H A D | vcf_iit.pl.in | 34 if ($wantp == 1 && $ref_allele =~ /^[ACGT]$/ && $alt_allele =~ /^[ACGT]$/) {
|
/dports/biology/emboss/EMBOSS-6.6.0/doc/programs/master/emboss/apps/inc/ |
H A D | infobase.output | 16 N ACGT N any_base 23 X ACGT X unknown
|
/dports/textproc/R-cran-stringi/stringi/man/ |
H A D | stri_match.Rd | 130 stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\\\2))')[[1]][,2] 132 stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\\\1')
|