/dports/science/bagel/bagel-1.2.2/src/smith/mrci/ |
H A D | MRCI_residualq1.cc | 184 auto I264 = make_shared<Tensor>(I264_index); in make_residualq1() local 185 auto tensor127 = vector<shared_ptr<Tensor>>{I0, t2, I264}; in make_residualq1() 191 auto tensor128 = vector<shared_ptr<Tensor>>{I264, Gamma85_(), v2_}; in make_residualq1() 197 auto tensor129 = vector<shared_ptr<Tensor>>{I264, Gamma86_(), v2_}; in make_residualq1()
|
/dports/devel/jetbrains-phpstorm/PhpStorm-213.6461.83/plugins/remote-dev-server/selfcontained/X11/xkb/keycodes/ |
H A D | jolla | 8 <I264> = 264; // Jolla phone has the wired headset button sending this keycode
|
/dports/devel/jetbrains-webstorm/WebStorm-213.6461.79/plugins/remote-dev-server/selfcontained/X11/xkb/keycodes/ |
H A D | jolla | 8 <I264> = 264; // Jolla phone has the wired headset button sending this keycode
|
/dports/x11/xkeyboard-config/xkeyboard-config-2.34/keycodes/ |
H A D | jolla | 8 <I264> = 264; // Jolla phone has the wired headset button sending this keycode
|
/dports/devel/jetbrains-webstorm/WebStorm-213.6461.79/plugins/remote-dev-server/selfcontained/X11/xkb/symbols/jolla_vndr/ |
H A D | sbj | 56 key <I264> { [ XF86Phone ] };
|
/dports/devel/jetbrains-phpstorm/PhpStorm-213.6461.83/plugins/remote-dev-server/selfcontained/X11/xkb/symbols/jolla_vndr/ |
H A D | sbj | 56 key <I264> { [ XF86Phone ] };
|
/dports/x11/xkeyboard-config/xkeyboard-config-2.34/symbols/jolla_vndr/ |
H A D | sbj | 56 key <I264> { [ XF86Phone ] };
|
/dports/lang/mono/mono-5.10.1.57/mono/tests/ |
H A D | async-exc-compilation.cs | 2939 I264 itf264 = (I264)o; in Long() 2944 itf264 = (I264)o; in Long() 4713 interface I264 interface
|
H A D | transparentproxy.cs | 2956 I264 itf264 = (I264)o; in Main() 2961 itf264 = (I264)o; in Main() 4683 interface I264 interface
|
/dports/science/bagel/bagel-1.2.2/src/smith/caspt2/ |
H A D | MSCASPT2_densityq.cc | 1553 auto I264 = make_shared<Tensor>(I264_index); in make_densityq() local 1554 auto tensor239 = vector<shared_ptr<Tensor>>{I263, l2, I264}; in make_densityq() 1560 auto tensor240 = vector<shared_ptr<Tensor>>{I264, Gamma65_(), t2}; in make_densityq()
|
H A D | SPCASPT2_densityq.cc | 1551 auto I264 = make_shared<Tensor>(I264_index); in make_densityq() local 1552 auto tensor253 = vector<shared_ptr<Tensor>>{I263, t2, I264}; in make_densityq() 1558 auto tensor254 = vector<shared_ptr<Tensor>>{I264, Gamma65_(), t2}; in make_densityq()
|
/dports/x11-toolkits/py-wxPython40/wxPython-4.0.7/samples/doodle/ |
H A D | sample.ddl | 1379 I264 1382 a(I264 6466 I264 6469 I264
|
/dports/cad/openroad/OpenROAD-2.0/src/psm/test/ |
H A D | gcd_spice_vss.spok | 1281 I264 VSS_118800_64400_1 0 1.3768e-07
|
H A D | gcd_spice_vdd.spok | 1535 I264 VDD_21600_67200_1 0 1.12141e-08
|
/dports/devel/llbuild/swift-llbuild-swift-DEVELOPMENT-SNAPSHOT-2017-12-10-a/perftests/Inputs/ |
H A D | llvm-only.ninja | 244 build N227: CAT I264 N101 N175 946 …I250 I251 I252 I253 I254 I255 I256 I257 I258 I259 I26 I260 I261 I262 I263 I264 I265 I266 I267 I268…
|
/dports/japanese/font-kanji26/ja-font-kanji26-1.0_3/ |
H A D | kanji26.ad | 259 M81@MPJ2=@?G0[<#X'>,QO"<O]TOAW.JG: U$'6I264"XA#+*2;$1)L#06,'E
|
/dports/games/xconq/xconq-7.5.0-0pre.0.20050612/doc/ |
H A D | PROJECTS | 2014 I264. Don't report elevation of units on terrain type where elevation
|
/dports/misc/gedkeeper/GEDKeeper-2.19.1/samples/ |
H A D | Ancient_Kingdoms.ged | 5347 0 @I264@ INDI 5389 1 CHIL @I264@ 5504 1 HUSB @I264@
|
H A D | Sample_PresidentsUSA.ged | 2823 0 @I264@ INDI 21254 1 WIFE @I264@ 21418 1 CHIL @I264@
|
/dports/science/rdkit/rdkit-Release_2021_03_5/rdkit/ML/Cluster/test_data/ |
H A D | struct.UPGMA.pkl | 9326 I264
|
H A D | struct.Wards.pkl | 15246 I264
|
/dports/lang/mono/mono-5.10.1.57/mcs/class/corlib/Test/resources/ |
H A D | Fergie.GED | 1773 0 @I264@ INDI 12734 1 CHIL @I264@
|
/dports/biology/seqan-apps/seqan-seqan-v2.4.0/apps/mason2/tests/ |
H A D | simulator.out8.sam | 680 …GGCTTGCGATGCATGTTTCGTGCTGAGGGGTCCGC &*7I42;:=(99:77(I6>(:=(3I866'G?'I3653'I264&E&*8I9'I'/I87>'G:>:…
|
/dports/textproc/py-gensim/gensim-4.0.1/gensim/test/test_data/ |
H A D | varembed_vectors.pkl | 777 I264 1650 I264
|
/dports/biology/emboss/EMBOSS-6.6.0/emboss/data/TAXONOMY/ |
H A D | names.dmp | 908657 685251 | Cadophora sp. I264 | | scientific name |
|