1# GFF entries for FBgn0031208, for testing. 2# 3# This is the first gene in FlyBase r5.23, and entries contain the full gene 4# model. To be able to understand, debug, and write tests, below are 1) a 5# simple graphical representation, and then 2) the explicit features defined by 6# the GFF. 7# 8# Simplified model (-- is UTR; == is CDS; .. is intron) 9# 10# -------===============...................=============---------- FBtr0300689 11# -------===============...................========........===---- FBtr0300690 12# 13# 14# Full model, including all features described below. Note that exons contain 15# UTRs and that: 16# 5'UTR + first CDS = first exon 17# 3'UTR + last CDS = last exon 18# middle exons = middle CDSs 19# 20# |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| gene 21# 22# 23# 24# ^^^^^^^^^^^^^^^^^^^^exon ^^^^^^^^^^^^^^^^^^^^^^^ exon <-| 25# -------5'UTR ----------3'UTR | FBtr0300689 26# =============CDS =============CDS | 27# ....................intron <-| 28# 29# 30# 31# 32# ^^^^^^^^^^^^^^^^^^^^exon ^^^^^^^^exon ^^^^^^^exon <-| 33# ----3'UTR | 34# ========CDS ===CDS | FBtr0300690 35# ....................intron | 36# ........intron <-| 37# 38# ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,protein 39# ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,protein 40# /////PCR product 41# 42# 43# A fake gene, on the opposite strand and starting 800 bp or so downstream. 44# 45# |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Fk_gene_1 46# ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Fk_gene_1:1 (exon) 47# ============================================================ CDS:Fk_gene_1 48# ------------------------------------------------------------ transcript_Fk_gene_1 49# 50# 51# Note that the ID for the first exon has been removed for testing the 52# automatic ID creation. In the database, this should come up as 53# "unnamed_exon_1". 54# 55chr2L FlyBase gene 7529 9484 . + . ID=FBgn0031208;Name=CG11023;Ontology_term=SO:0000010,SO:0000087,GO:0008234,GO:0006508;Dbxref=FlyBase:FBan0011023,FlyBase_Annotation_IDs:CG11023,GB:AE003590,GB_protein:AAO41164,GB:AI944728,GB:AJ564667,GB_protein:CAD92822,GB:BF495604,UniProt/TrEMBL:Q6KEV3,UniProt/TrEMBL:Q86BM6,INTERPRO:IPR003653,BIOGRID:59420,dedb:5870,GenomeRNAi_gene:33155,ihop:59383;derived_computed_cyto=21A5-21A5;gbunit=AE014134 56chr2L FlyBase mRNA 7529 9484 . + . ID=FBtr0300689;Name=CG11023-RB;Parent=FBgn0031208;Dbxref=FlyBase_Annotation_IDs:CG11023-RB;score_text=Strongly Supported;score=11 57chr2L FlyBase mRNA 7529 9484 . + . ID=FBtr0300690;Name=CG11023-RC;Parent=FBgn0031208;Dbxref=FlyBase_Annotation_IDs:CG11023-RC;score_text=Moderately Supported;score=7 58 59# ID for the first exon has been removed for testing IDs using Name instead of 60# ID, and the second exon has neither ID nor Name, for testing auto-ID 61# creation. 62chr2L FlyBase five_prime_UTR 7529 7679 . + . ID=five_prime_UTR_FBgn0031208:1_737;Name=CG11023-u5;Parent=FBtr0300689,FBtr0300690 63chr2L FlyBase exon 7529 8116 . + . Name=CG11023:1;Parent=FBtr0300689,FBtr0300690 64chr2L FlyBase CDS 7680 8116 . + 0 ID=CDS_FBgn0031208:1_737;Name=CG11023-cds;Parent=FBtr0300689,FBtr0300690 65chr2L FlyBase intron 8117 8192 . + . ID=intron_FBgn0031208:1_FBgn0031208:2;Name=CG11023-in;Parent=FBtr0300690 66chr2L FlyBase intron 8117 8192 . + . ID=intron_FBgn0031208:1_FBgn0031208:3;Name=CG11023-in;Parent=FBtr0300689 67chr2L FlyBase exon 8193 8589 . + . Parent=FBtr0300690 68chr2L FlyBase exon 8193 9484 . + . ID=FBgn0031208:3;Name=CG11023:3;Parent=FBtr0300689 69chr2L FlyBase CDS 8193 8610 . + 2 ID=CDS_FBgn0031208:3_737;Name=CG11023-cds;Parent=FBtr0300689 70chr2L FlyBase CDS 8193 8589 . + 2 ID=CDS_FBgn0031208:2_737;Name=CG11023-cds;Parent=FBtr0300690 71chr2L FlyBase exon 8668 9484 . + . ID=FBgn0031208:4;Name=CG11023:4;Parent=FBtr0300690 72chr2L FlyBase CDS 8668 9276 . + 0 ID=CDS_FBgn0031208:4_737;Name=CG11023-cds;Parent=FBtr0300690 73chr2L FlyBase intron 8590 8667 . + . ID=intron_FBgn0031208:2_FBgn0031208:4;Name=CG11023-in;Parent=FBtr0300690 74chr2L FlyBase three_prime_UTR 8611 9484 . + . ID=three_prime_UTR_FBgn0031208:3_737;Name=CG11023-u3;Parent=FBtr0300689 75chr2L FlyBase three_prime_UTR 9277 9484 . + . ID=three_prime_UTR_FBgn0031208:4_737;Name=CG11023-u3;Parent=FBtr0300690 76chr2L FlyBase protein 7680 9273 . + . ID=FBpp0289914;Name=CG11023-PC;Derives_from=FBtr0300690;Dbxref=FlyBase_Annotation_IDs:CG11023-PC;derived_isoelectric_point=7.15;derived_molecular_weight=55247.1 77chr2L FlyBase protein 7680 8607 . + . ID=FBpp0289913;Name=CG11023-PB;Derives_from=FBtr0300689;Dbxref=FlyBase_Annotation_IDs:CG11023-PB;derived_isoelectric_point=6.96;derived_molecular_weight=32613.1 78chr2L DGRC_1 pcr_product 8272 8589 . + . ID=INC121G01_pcr_product;Name=INC121G01;Dbxref=DGRC-1:INC121G01 79 80# Fake gene, on the opposite strand. Useful for testing proximity routines. 81chr2L FAKE gene 10000 11000 . - . ID=Fk_gene_1; 82chr2L FAKE mRNA 10000 11000 . - . ID=transcript_Fk_gene_1;Parent=Fk_gene_1; 83chr2L FAKE exon 10000 11000 . - . ID=Fk_gene_1:1;Parent=transcript_Fk_gene_1; 84chr2L FAKE CDS 10000 11000 . - . ID=CDS:Fk_gene_1:1; Parent=transcript_Fk_gene_1 85# 86# Another fake gene, used for promoter truncation tests. This one is non-coding. 87chr2L FAKE gene 11500 12500 . - . ID=Fk_gene_2 88chr2L FAKE mRNA 11500 12500 . - . ID=transcript_Fk_gene_2;Parent=Fk_gene_2 89chr2L FAKE exon 11500 12500 . + . ID=Fk_gene_2:1;Parent=transcript_Fk_gene_2 90>chr2L 91AAATAGTGATGCTAGCTAGCTAGCTCGTACGATCGTCGATCGATCGATCGTACGATCGATCCGCGCGCGCGCGCGATATATAGCTTGATGCTGATGTCTGACGACACTG 92ACTGACTGCCGCTAGCGCGTATCGCGCGCGCATCGTACGCTGCTACGTCGATCGCGCGCGCTATAGCTACGTCGATCGATCGTAGCTAGCTAGCTAGCTACGCGCGCGC 93