1Seq-entry ::= set { 2 class genbank , 3 seq-set { 4 seq { 5 id { 6 local 7 str "badinst1" } , 8 inst { 9 repr virtual , 10 mol dna , 11 length 549 , 12 seq-data 13 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 14FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 15ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 168BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H , 17 ext 18 delta { 19 literal { 20 length 10 , 21 seq-data 22 iupacna "AATTGGCCAA" } , 23 literal { 24 length 100 , 25 fuzz 26 lim unk } , 27 literal { 28 length 10 , 29 seq-data 30 iupacna "AATTGGCCAA" } } } } , 31 seq { 32 id { 33 local 34 str "badinst2" } , 35 inst { 36 repr ref , 37 mol dna , 38 length 549 , 39 seq-data 40 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 41FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 42ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 438BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H , 44 ext 45 delta { 46 literal { 47 length 10 , 48 seq-data 49 iupacna "AATTGGCCAA" } , 50 literal { 51 length 100 , 52 fuzz 53 lim unk } , 54 literal { 55 length 10 , 56 seq-data 57 iupacna "AATTGGCCAA" } } } } , 58 seq { 59 id { 60 local 61 str "badinst3" } , 62 inst { 63 repr raw , 64 mol dna , 65 length 549 , 66 seq-data 67 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 68FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 69ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 708BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H , 71 ext 72 delta { 73 literal { 74 length 10 , 75 seq-data 76 iupacna "AATTGGCCAA" } , 77 literal { 78 length 100 , 79 fuzz 80 lim unk } , 81 literal { 82 length 10 , 83 seq-data 84 iupacna "AATTGGCCAA" } } } } , 85 seq { 86 id { 87 local 88 str "badinst4" } , 89 inst { 90 repr const , 91 mol dna , 92 length 549 , 93 seq-data 94 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 95FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 96ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 978BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H , 98 ext 99 delta { 100 literal { 101 length 10 , 102 seq-data 103 iupacna "AATTGGCCAA" } , 104 literal { 105 length 100 , 106 fuzz 107 lim unk } , 108 literal { 109 length 10 , 110 seq-data 111 iupacna "AATTGGCCAA" } } } } , 112 seq { 113 id { 114 local 115 str "badinst5" } , 116 inst { 117 repr delta , 118 mol dna , 119 length 549 , 120 seq-data 121 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 122FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 123ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 1248BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H , 125 ext 126 delta { 127 literal { 128 length 10 , 129 seq-data 130 iupacna "AATTGGCCAA" } , 131 literal { 132 length 100 , 133 fuzz 134 lim unk } , 135 literal { 136 length 10 , 137 seq-data 138 iupacna "AATTGGCCAA" } } } } , 139 seq { 140 id { 141 local 142 str "badinst6" } , 143 inst { 144 repr raw , 145 mol dna , 146 length 549 , 147 ext 148 delta { 149 literal { 150 length 10 , 151 seq-data 152 iupacna "AATTGGCCAA" } , 153 literal { 154 length 100 , 155 fuzz 156 lim unk } , 157 literal { 158 length 10 , 159 seq-data 160 iupacna "AATTGGCCAA" } } } } , 161 seq { 162 id { 163 local 164 str "badinst7" } , 165 inst { 166 repr raw , 167 mol aa , 168 length 549 , 169 topology circular , 170 strand ds , 171 seq-data 172 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 173FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 174ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 1758BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 176 seq { 177 id { 178 local 179 str "badinst8" } , 180 inst { 181 repr raw , 182 mol not-set , 183 length 549 , 184 topology circular , 185 strand ds , 186 seq-data 187 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 188FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 189ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 1908BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 191 seq { 192 id { 193 local 194 str "badinst9" } , 195 inst { 196 repr raw , 197 mol other , 198 length 549 , 199 topology circular , 200 strand ds , 201 seq-data 202 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 203FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 204ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 2058BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 206 seq { 207 id { 208 local 209 str "badinst10" } , 210 inst { 211 repr raw , 212 mol na , 213 length 549 , 214 topology circular , 215 strand ds , 216 seq-data 217 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 218FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 219ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 2208BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 221 seq { 222 id { 223 local 224 str "badinst11" } , 225 inst { 226 repr raw , 227 mol dna , 228 length 549 , 229 fuzz 230 lim unk , 231 seq-data 232 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 233FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 234ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 2358BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 236 seq { 237 id { 238 local 239 str "badinst12" } , 240 inst { 241 repr raw , 242 mol dna , 243 length 0 , 244 seq-data 245 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 246FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 247ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 2488BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 249 seq { 250 id { 251 local 252 str "badinst13" } , 253 inst { 254 repr raw , 255 mol aa , 256 length 16 , 257 seq-data 258 iupacna "AATTGGCCAATTGGCC" } } , 259 seq { 260 id { 261 local 262 str "badinst14" } , 263 inst { 264 repr raw , 265 mol na , 266 length 16 , 267 seq-data 268 iupacaa "QBTTQRSTSSTTAAGC" } } , 269 seq { 270 id { 271 local 272 str "badinst15" } , 273 inst { 274 repr raw , 275 mol na , 276 length 10 , 277 seq-data 278 iupacna "AATTGGCCAATTGGCC" } } , 279 seq { 280 id { 281 local 282 str "badinst16" } , 283 inst { 284 repr raw , 285 mol na , 286 length 10 , 287 seq-data 288 iupacna "AATTQGCCAATTGGCC" } } , 289 seq { 290 id { 291 local 292 str "badinst17_reprseg" } , 293 inst { 294 repr seg , 295 mol aa , 296 length 30 , 297 ext 298 seg { 299 int { 300 from 0 , 301 to 9 , 302 strand plus , 303 id 304 other { 305 accession "YP_238673" , 306 version 1 } , 307 fuzz-from 308 lim lt } , 309 int { 310 from 20 , 311 to 29 , 312 strand plus , 313 id 314 other { 315 accession "YP_238673" , 316 version 1 } } } } } , 317 seq { 318 id { 319 local 320 str "badinst18" } , 321 descr { 322 molinfo { 323 tech est } } , 324 inst { 325 repr delta , 326 mol dna , 327 length 120 , 328 ext 329 delta { 330 literal { 331 length 10 , 332 seq-data 333 iupacna "AATTGGCCAA" } , 334 literal { 335 length 100 , 336 fuzz 337 lim unk } , 338 literal { 339 length 10 , 340 seq-data 341 iupacna "AATTGGCCAA" } } } } , 342 seq { 343 id { 344 local 345 str "badinst19" , 346 local 347 str "another local ID" } , 348 descr { 349 molinfo { 350 biomol rRNA , 351 tech sts } } , 352 inst { 353 repr raw , 354 mol dna , 355 length 549 , 356 seq-data 357 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 358FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 359ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 3608BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 361 seq { 362 id { 363 other { 364 name "badinst 20" } } , 365 descr { 366 molinfo { 367 biomol genomic , 368 tech sts } } , 369 inst { 370 repr raw , 371 mol rna , 372 length 549 , 373 seq-data 374 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3FB77 375FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE3070D1 376ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF33A0F 3778BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } } , 378 seq { 379 id { 380 local 381 str "badinst21" } , 382 inst { 383 repr raw , 384 mol aa , 385 length 18 , 386 seq-data 387 iupacaa "AATTGCCAATTGGCCXXX" } } , 388 seq { 389 id { 390 local 391 str "badinst22" } , 392 descr { 393 molinfo { 394 tech wgs } } , 395 inst { 396 repr delta , 397 mol dna , 398 length 141 , 399 ext 400 delta { 401 literal { 402 length 10 , 403 seq-data 404 iupacna "AATTGGCCAA" } , 405 literal { 406 length 100 , 407 fuzz 408 lim unk } , 409 literal { 410 length 31 , 411 seq-data 412 iupacna "AATTNNNNNNNNNNNNNNNNNNNNNGGCCAA" } } } } , 413 seq { 414 id { 415 local 416 str "badinst23" } , 417 inst { 418 repr delta , 419 mol dna , 420 length 30 , 421 ext 422 delta { 423 literal { 424 length 10 , 425 seq-data 426 iupacna "AATTGGCCAA" } , 427 literal { 428 length 0 , 429 fuzz 430 lim unk } , 431 literal { 432 length 10 , 433 seq-data 434 iupacna "AATTGGCCAA" } , 435 literal { 436 length 0 } , 437 literal { 438 length 10 , 439 seq-data 440 iupacna "AATTGGCCAA" } } } } , 441 seq { 442 id { 443 swissprot { 444 accession "badinst24" , 445 version 1 } } , 446 descr { 447 user { 448 type 449 str "TpaAssembly" , 450 data { 451 } } } , 452 inst { 453 repr delta , 454 mol dna , 455 length 30 , 456 ext 457 delta { 458 literal { 459 length 10 , 460 seq-data 461 iupacna "AATTGGCCAA" } , 462 literal { 463 length 0 , 464 fuzz 465 lim unk } , 466 literal { 467 length 10 , 468 seq-data 469 iupacna "AATTGGCCAA" } , 470 literal { 471 length 0 } , 472 literal { 473 length 10 , 474 seq-data 475 iupacna "AATTGGCCAA" } } } } , 476 seq { 477 id { 478 local 479 str "badinst25" } , 480 descr { 481 molinfo { 482 tech htgs-2 } , 483 user { 484 type 485 str "TpaAssembly" , 486 data { 487 } } } , 488 inst { 489 repr delta , 490 mol dna , 491 length 35 , 492 ext 493 delta { 494 literal { 495 length 10 , 496 seq-data 497 iupacna "AATTGGCCAA" } , 498 literal { 499 length 10 , 500 seq-data 501 iupacna "AATTGGCCAA" } , 502 literal { 503 length 10 , 504 seq-data 505 iupacna "AATTGGCCAA" } , 506 loc 507 int { 508 from 0 , 509 to 4 , 510 id 511 genbank { 512 accession "AY123456" , 513 version 1 } } } , 514 hist { 515 assembly { 516 { 517 type global , 518 dim 2 , 519 segs 520 denseg { 521 dim 2 , 522 numseg 1 , 523 ids { 524 local 525 str "badinst25" , 526 genbank { 527 accession "AY123456" , 528 version 1 } } , 529 starts { 530 0 , 531 0 } , 532 lens { 533 30 } } } } } } } , 534 seq { 535 id { 536 local 537 str "badinst26_prot" , 538 general { 539 db "WGS:AABU" , 540 tag 541 str "chrUn.0030" } } , 542 inst { 543 repr raw , 544 mol aa , 545 length 9 , 546 seq-data 547 ncbieaa "XXQRST-PP" } } , 548 seq { 549 id { 550 local 551 str "badinst27" } , 552 inst { 553 repr raw , 554 mol dna , 555 length 20 , 556 seq-data 557 iupacna "NNNNAAAATTTTGGGGCCCC" } } , 558 seq { 559 id { 560 local 561 str "badinst28" } , 562 inst { 563 repr delta , 564 mol dna , 565 length 324 , 566 ext 567 delta { 568 literal { 569 length 100 , 570 fuzz 571 lim unk } , 572 literal { 573 length 12 , 574 seq-data 575 iupacna "AATTGGCCAANN" } , 576 literal { 577 length 100 , 578 fuzz 579 lim unk } , 580 literal { 581 length 12 , 582 seq-data 583 iupacna "NNAATTGGCCAA" } , 584 literal { 585 length 100 , 586 fuzz 587 lim unk } } } } , 588 seq { 589 id { 590 genbank { 591 accession "badinst26" , 592 version 1 } } , 593 descr { 594 molinfo { 595 biomol genomic } , 596 title "complete genome" } , 597 inst { 598 repr raw , 599 mol dna , 600 length 16 , 601 topology circular , 602 seq-data 603 iupacna "AATTGGCCAATTGGCC" } } , 604 seq { 605 id { 606 local 607 str "badinst29" } , 608 inst { 609 repr delta , 610 mol dna , 611 length 33 , 612 ext 613 delta { 614 loc 615 int { 616 from 0 , 617 to 10 , 618 id 619 genbank { 620 accession "AY123456" , 621 version 1 } } , 622 loc 623 int { 624 from 0 , 625 to 10 , 626 id 627 genbank { 628 accession "AY123456" , 629 version 1 } } , 630 loc 631 int { 632 from 0 , 633 to 10 , 634 id 635 genbank { 636 accession "AY123457" , 637 version 1 } } } } } , 638 seq { 639 id { 640 local 641 str "badinst30" } , 642 descr { 643 molinfo { 644 tech tsa } } , 645 inst { 646 repr raw , 647 mol dna , 648 length 110 , 649 seq-data 650 iupacna "AAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 651NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT" } } , 652 seq { 653 id { 654 local 655 str "badinst31" } , 656 descr { 657 molinfo { 658 tech tsa } } , 659 inst { 660 repr delta , 661 mol dna , 662 length 33 , 663 ext 664 delta { 665 loc 666 int { 667 from 0 , 668 to 10 , 669 id 670 gi 0 } , 671 loc 672 int { 673 from 0 , 674 to 10 , 675 id 676 local 677 str "badinst31" } , 678 loc 679 whole 680 genbank { 681 accession "AY123457" , 682 version 1 } } } } , 683 seq { 684 id { 685 local 686 str "badinst32" } , 687 inst { 688 repr raw , 689 mol dna , 690 length 110 , 691 seq-data 692 iupacna "AAAAANNNNNNNNNNNNNNNNN----NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 693NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT" } } , 694 seq { 695 id { 696 local 697 str "badinst33" } , 698 descr { 699 modif { 700 other } , 701 source { 702 org { 703 taxname "first organism" } , 704 subtype { 705 { 706 subtype country , 707 name "wonderland" } } } , 708 source { 709 org { 710 taxname "first organism" } , 711 subtype { 712 { 713 subtype country , 714 name "alice" } } } } , 715 inst { 716 repr delta , 717 mol dna , 718 length 112 , 719 ext 720 delta { 721 literal { 722 length 12 , 723 seq-data 724 iupacna "AATTGGCCAANN" } , 725 literal { 726 length 100 , 727 fuzz 728 lim unk } } } } , 729 seq { 730 id { 731 local 732 str "baddescr1" } , 733 descr { 734 mol-type mRNA , 735 mol-type tRNA , 736 mol-type rRNA , 737 modif { 738 dna , 739 rna , 740 extrachrom , 741 plasmid , 742 mitochondrial , 743 chloroplast , 744 kinetoplast , 745 cyanelle , 746 synthetic , 747 recombinant , 748 partial , 749 complete , 750 mutagen , 751 natmut , 752 transposon , 753 insertion-seq , 754 no-left , 755 no-right , 756 macronuclear , 757 proviral , 758 est , 759 sts , 760 survey , 761 chromoplast , 762 genemap , 763 restmap , 764 physmap , 765 other } , 766 genbank { 767 origin "foo" } , 768 genbank { 769 origin "bar" } , 770 embl { 771 creation-date 772 std { 773 year 1980 , 774 month 1 , 775 day 1 } , 776 update-date 777 std { 778 year 1980 , 779 month 1 , 780 day 1 } , 781 extra-acc { 782 "AY123456" , 783 "AY123457" } } , 784 embl { 785 creation-date 786 std { 787 year 1980 , 788 month 2 , 789 day 8 } , 790 update-date 791 std { 792 year 1980 , 793 month 2 , 794 day 8 } , 795 extra-acc { 796 "AY123458" , 797 "AY123459" } } , 798 pir { 799 placement "foo" } , 800 pir { 801 placement "bar" } } , 802 inst { 803 repr raw , 804 mol dna , 805 length 18 , 806 seq-data 807 iupacna "AATTGGCCAATTGGCCNN" } } , 808 seq { 809 id { 810 genbank { 811 accession "baddescr2" , 812 version 1 } } , 813 descr { 814 source { 815 genome transposon , 816 org { 817 orgname { 818 mod { 819 { 820 subtype other , 821 subname "variety:wikki" } } } } , 822 subtype { 823 { 824 subtype transposon-name , 825 name "foo" } , 826 { 827 subtype other , 828 name "ecotype:bar" } , 829 { 830 subtype germline , 831 name "a" } , 832 { 833 subtype rearranged , 834 name "a" } , 835 { 836 subtype transgenic , 837 name "a" } , 838 { 839 subtype environmental-sample , 840 name "a" } , 841 { 842 subtype metagenomic , 843 name "a" } , 844 { 845 subtype sex , 846 name "P" } , 847 { 848 subtype lat-lon , 849 name "50 S 50 E" } , 850 { 851 subtype country , 852 name "Ukraine" } , 853 { 854 subtype mating-type , 855 name "hermaphrodite" } } , 856 is-focus NULL } , 857 user { 858 type 859 str "RefGeneTracking" , 860 data { 861 } } , 862 molinfo { 863 biomol genomic , 864 completeness complete } , 865 pub { 866 pub { 867 pmid 1 , 868 pmid 1 } } , 869 pub { 870 pub { 871 pmid 1 , 872 pmid 2 } } , 873 pub { 874 pub { 875 muid 3 , 876 muid 3 } } , 877 pub { 878 pub { 879 muid 3 , 880 muid 4 } } , 881 title "a useless definition line [company=bad]:" , 882 title "a second useless definition line" } , 883 inst { 884 repr raw , 885 mol dna , 886 length 18 , 887 seq-data 888 iupacna "AATTGGCCAATTGGCCNN" } } , 889 seq { 890 id { 891 local 892 str "baddescr3" } , 893 descr { 894 source { 895 org { 896 orgname { 897 lineage "Viruses; other stuff" } } , 898 subtype { 899 { 900 subtype sex , 901 name "hermaphrodite" } , 902 { 903 subtype mating-type , 904 name "should not be here" } , 905 { 906 subtype plasmid-name , 907 name "should not be here" } , 908 { 909 subtype plastid-name , 910 name "chloroplast" } , 911 { 912 subtype plastid-name , 913 name "chromoplast" } , 914 { 915 subtype plastid-name , 916 name "kinetoplast" } , 917 { 918 subtype plastid-name , 919 name "plastid" } , 920 { 921 subtype plastid-name , 922 name "apicoplast" } , 923 { 924 subtype plastid-name , 925 name "leucoplast" } , 926 { 927 subtype plastid-name , 928 name "proplastid" } , 929 { 930 subtype plastid-name , 931 name "unrecognized name" } , 932 { 933 subtype frequency , 934 name "1" } , 935 { 936 subtype frequency , 937 name "kenneth" } , 938 { 939 subtype cell-line , 940 name "kenneth" } , 941 { 942 subtype cell-type , 943 name "kenneth" } , 944 { 945 subtype tissue-type , 946 name "kenneth" } , 947 { 948 subtype lat-lon , 949 name "50 S 31 E" } , 950 { 951 subtype country , 952 name "Ukraine" } , 953 { 954 subtype fwd-primer-seq , 955 name "(aaaa,aaaa)" } , 956 { 957 subtype rev-primer-seq , 958 name "(cccc,cccc)" } , 959 { 960 subtype collection-date , 961 name "not a valid date" } } } , 962 comment " " } , 963 inst { 964 repr raw , 965 mol dna , 966 length 18 , 967 seq-data 968 iupacna "AATTGGCCAATTGGCCNN" } } , 969 seq { 970 id { 971 local 972 str "baddescr4" } , 973 descr { 974 name "name1" , 975 name "name2" , 976 comment "comment" , 977 comment "comment" , 978 source { 979 org { 980 orgname { 981 lineage "Viruses; other stuff" } } , 982 subtype { 983 { 984 subtype sex , 985 name "hermaphrodite" } , 986 { 987 subtype cell-line , 988 name "a" } , 989 { 990 subtype cell-type , 991 name "b" } , 992 { 993 subtype tissue-type , 994 name "c" } , 995 { 996 subtype lat-lon , 997 name "not a good latlon format" } , 998 { 999 subtype lat-lon , 1000 name "another bad latlon format" } , 1001 { 1002 subtype lat-lon , 1003 name "1000 N 500 E" } , 1004 { 1005 subtype fwd-primer-seq , 1006 name "qwerty" } , 1007 { 1008 subtype fwd-primer-name , 1009 name "AATTGGCCAATTGGCC" } , 1010 { 1011 subtype rev-primer-seq , 1012 name "qwerty" } , 1013 { 1014 subtype rev-primer-name , 1015 name "AATTGGCCAATTGGCC" } , 1016 { 1017 subtype fwd-primer-seq , 1018 name "aaattgggcc" } , 1019 { 1020 subtype fwd-primer-name , 1021 name "ok primer name" } , 1022 { 1023 subtype rev-primer-seq , 1024 name "ccaaattgggccc" } , 1025 { 1026 subtype rev-primer-name , 1027 name "ok rev primer name" } , 1028 { 1029 subtype collection-date , 1030 name "05-Aug-2038" } } } } , 1031 inst { 1032 repr raw , 1033 mol dna , 1034 length 18 , 1035 seq-data 1036 iupacna "AATTGGCCAATTGGCCNN" } } , 1037 seq { 1038 id { 1039 local 1040 str "baddescr5" } , 1041 descr { 1042 user { 1043 type 1044 str "RefGeneTracking" , 1045 data { 1046 { 1047 label 1048 str "Status" , 1049 data 1050 str "Not a legal status" } } } , 1051 source { 1052 org { 1053 orgname { 1054 mod { 1055 { 1056 subtype nat-host , 1057 subname "Looks sciency" } } } } , 1058 subtype { 1059 { 1060 subtype lat-lon , 1061 name "45 N 70 W" } , 1062 { 1063 subtype country , 1064 name "USA: Florida" } } } } , 1065 inst { 1066 repr raw , 1067 mol dna , 1068 length 18 , 1069 seq-data 1070 iupacna "AATTGGCCAATTGGCCNN" } } , 1071 seq { 1072 id { 1073 local 1074 str "baddescr6" } , 1075 descr { 1076 pub { 1077 pub { 1078 sub { 1079 authors { 1080 names 1081 std { 1082 { 1083 name 1084 name { 1085 last "et al." } } , 1086 { 1087 name 1088 name { 1089 last "et" , 1090 initials "al" } } , 1091 { 1092 name 1093 name { 1094 last "et al." , 1095 first "Colleen" , 1096 initials "C.J." } } } , 1097 affil 1098 std { 1099 affil " inst " , 1100 div " dept " , 1101 city " city " , 1102 sub " state " , 1103 street " address " , 1104 email " email " , 1105 fax " fax " , 1106 phone " phone " , 1107 postal-code " code " } } , 1108 date 1109 std { 1110 year 2097 , 1111 month 255 , 1112 day 191 , 1113 season "'#*##" } } } } , 1114 pub { 1115 pub { 1116 sub { 1117 authors { 1118 names 1119 std { 1120 { 1121 name 1122 name { 1123 last "?" } } } , 1124 affil 1125 std { 1126 affil " inst " , 1127 div " dept " , 1128 city " city " , 1129 country "USA" , 1130 street " address " , 1131 email " email " , 1132 fax " fax " , 1133 phone " phone " , 1134 postal-code " code " } } } } } , 1135 pub { 1136 pub { 1137 article { 1138 from 1139 journal { 1140 title { 1141 name "" } , 1142 imp { 1143 date 1144 str "?" , 1145 pages "0" } } } } } , 1146 pub { 1147 pub { 1148 article { 1149 from 1150 journal { 1151 title { 1152 name "" } , 1153 imp { 1154 date 1155 str "?" , 1156 pages "123-abc" } } } } } , 1157 pub { 1158 pub { 1159 article { 1160 from 1161 journal { 1162 title { 1163 name "" } , 1164 imp { 1165 date 1166 str "?" , 1167 pages "0-150" } } } } } , 1168 pub { 1169 pub { 1170 article { 1171 from 1172 journal { 1173 title { 1174 name "" } , 1175 imp { 1176 date 1177 str "?" , 1178 pages "60-50" } } } } } , 1179 pub { 1180 pub { 1181 article { 1182 from 1183 journal { 1184 title { 1185 name "" } , 1186 imp { 1187 date 1188 str "?" , 1189 pages "60--50" } } } } } , 1190 pub { 1191 pub { 1192 article { 1193 from 1194 journal { 1195 title { 1196 name "" } , 1197 imp { 1198 date 1199 str "?" , 1200 pages "10-150" } } } } } , 1201 pub { 1202 pub { 1203 medline { 1204 em 1205 str "?" , 1206 cit { 1207 from 1208 journal { 1209 title { 1210 name "" } , 1211 imp { 1212 date 1213 str "?" } } } } } } , 1214 pub { 1215 pub { 1216 gen { 1217 cit "This is a cit-gen with a bad date." , 1218 authors { 1219 names 1220 str { 1221 "An unstructured name" } } , 1222 date 1223 std { 1224 year 2038 , 1225 month 13 } , 1226 title "This is a cit-gen." } , 1227 pmid 6 } } , 1228 pub { 1229 pub { 1230 article { 1231 from 1232 journal { 1233 title { 1234 name "article with bad date" } , 1235 imp { 1236 date 1237 std { 1238 year 2038 , 1239 month 12 , 1240 day 32 } , 1241 pages "1-20" } } } } } , 1242 pub { 1243 pub { 1244 gen { 1245 cit "Title=This is a cit-gen." , 1246 authors { 1247 names 1248 str { 1249 "An unstructured name" } } , 1250 serial-number 42 , 1251 title "This is a cit-gen." } , 1252 equiv { 1253 gen { 1254 cit "Journal=This is a cit-gen without authors. It should 1255 trigger a validator error." , 1256 authors { 1257 names 1258 str { 1259 "?" } } , 1260 serial-number 42 , 1261 title "This is a cit-gen without authors. It should trigger a 1262 validator error." } , 1263 sub { 1264 authors { 1265 names 1266 std { 1267 { 1268 name 1269 name { 1270 last "Bollin" } } } } } } } } , 1271 pub { 1272 pub { 1273 article { 1274 from 1275 journal { 1276 title { 1277 name "" } , 1278 imp { 1279 date 1280 str "?" , 1281 prepub submitted , 1282 pubstatus aheadofprint } } } } } , 1283 pub { 1284 pub { 1285 article { 1286 from 1287 journal { 1288 title { 1289 name "" } , 1290 imp { 1291 date 1292 str "?" , 1293 prepub in-press , 1294 pubstatus epublish } } } } } , 1295 pub { 1296 pub { 1297 sub { 1298 authors { 1299 names 1300 std { 1301 { 1302 name 1303 consortium "this one consortium" } , 1304 { 1305 name 1306 consortium "this one consortium" } , 1307 { 1308 name 1309 consortium " " } , 1310 { 1311 name 1312 consortium "this other consortium" } } } } } } , 1313 pub { 1314 pub { 1315 gen { 1316 cit "This is a cit-gen with serial number 43." , 1317 authors { 1318 names 1319 str { 1320 "An unstructured name" } } , 1321 serial-number 43 , 1322 title "This is a cit-gen." } } } , 1323 pub { 1324 pub { 1325 gen { 1326 cit "This is also 43." , 1327 authors { 1328 names 1329 str { 1330 "An unstructured name" } } , 1331 serial-number 43 , 1332 title "This is a cit-gen." } } } , 1333 pub { 1334 pub { 1335 gen { 1336 cit "This is 44." , 1337 authors { 1338 names 1339 str { 1340 "An unstructured name" } } , 1341 serial-number 44 , 1342 title "This is a cit-gen." } } } , 1343 pub { 1344 pub { 1345 gen { 1346 cit "This is 45." , 1347 authors { 1348 names 1349 str { 1350 "An unstructured name" } } , 1351 serial-number 45 , 1352 title "This is a cit-gen." } } } , 1353 pub { 1354 pub { 1355 gen { 1356 cit "This is also 45." , 1357 authors { 1358 names 1359 str { 1360 "An unstructured name" } } , 1361 serial-number 45 , 1362 title "This is a cit-gen." } } } , 1363 create-date 1364 std { 1365 year 2038 , 1366 month 13 , 1367 day 3 } , 1368 update-date 1369 std { 1370 year 2038 , 1371 month 12 , 1372 day 32 } , 1373 source { 1374 genome chromosome , 1375 org { 1376 orgname { 1377 mod { 1378 { 1379 subtype acronym , 1380 subname "(no right" } , 1381 { 1382 subtype acronym , 1383 subname "no left)" } , 1384 { 1385 subtype bio-material , 1386 subname ":coll:specid" } , 1387 { 1388 subtype bio-material , 1389 subname ":coll:" } , 1390 { 1391 subtype bio-material , 1392 subname "::" } , 1393 { 1394 subtype bio-material , 1395 subname "abs:coll:specid" } , 1396 { 1397 subtype bio-material , 1398 subname "abb:specid" } , 1399 { 1400 subtype bio-material , 1401 subname "ABB:coll:specid" } , 1402 { 1403 subtype culture-collection , 1404 subname "unstructured value" } , 1405 { 1406 subtype culture-collection , 1407 subname "abc:def:ghi" } } } } , 1408 subtype { 1409 { 1410 subtype clone , 1411 name "[no right" } , 1412 { 1413 subtype clone , 1414 name "no left]" } , 1415 { 1416 subtype country , 1417 name "australia" } , 1418 { 1419 subtype country , 1420 name "Siam" } } } } , 1421 inst { 1422 repr raw , 1423 mol dna , 1424 length 18 , 1425 seq-data 1426 iupacna "AATTGGCCAATTGGCCNN" } , 1427 annot { 1428 { 1429 data 1430 ftable { 1431 { 1432 data 1433 pub { 1434 pub { 1435 article { 1436 from 1437 journal { 1438 title { 1439 name "" } , 1440 imp { 1441 date 1442 str "?" } } } } } , 1443 location 1444 int { 1445 from 0 , 1446 to 6 , 1447 strand plus , 1448 id 1449 local 1450 str "baddescr6" } } } } } } , 1451 set { 1452 class pop-set , 1453 seq-set { 1454 seq { 1455 id { 1456 local 1457 str "pop1" } , 1458 descr { 1459 comment "[123456]" , 1460 molinfo { 1461 biomol genomic } , 1462 source { 1463 genome kinetoplast , 1464 org { 1465 taxname "first organism" , 1466 orgname { 1467 mod { 1468 { 1469 subtype 0 , 1470 subname "foo" } , 1471 { 1472 subtype 1 , 1473 subname "bar" } } , 1474 lineage "something undetermined" } } } } , 1475 inst { 1476 repr raw , 1477 mol dna , 1478 length 12 , 1479 seq-data 1480 iupacna "AATTGGCCAANN" } , 1481 annot { 1482 { 1483 data 1484 ftable { 1485 { 1486 data 1487 biosrc { 1488 genome nucleomorph , 1489 org { 1490 taxname "a different taxname" , 1491 orgname { 1492 lineage "something undetermined" } } , 1493 subtype { 1494 { 1495 subtype chromosome , 1496 name "chromosome 1" } , 1497 { 1498 subtype 0 , 1499 name "something" } , 1500 { 1501 subtype chromosome , 1502 name "chromosome 2" } } , 1503 is-focus NULL } , 1504 location 1505 int { 1506 from 0 , 1507 to 6 , 1508 strand plus , 1509 id 1510 local 1511 str "pop1" } } } } } } , 1512 seq { 1513 id { 1514 local 1515 str "pop2" } , 1516 descr { 1517 molinfo { 1518 biomol rRNA } , 1519 source { 1520 org { 1521 taxname "second organism" } } } , 1522 inst { 1523 repr raw , 1524 mol dna , 1525 length 12 , 1526 seq-data 1527 iupacna "AATTGGCCAANN" } } , 1528 set { 1529 class nuc-prot , 1530 seq-set { 1531 seq { 1532 id { 1533 local 1534 str "pop3" } , 1535 descr { 1536 molinfo { 1537 biomol genomic } } , 1538 inst { 1539 repr raw , 1540 mol dna , 1541 length 12 , 1542 seq-data 1543 iupacna "AATTGGCCAANN" } } , 1544 seq { 1545 id { 1546 local 1547 str "pop3_prot" } , 1548 descr { 1549 molinfo { 1550 biomol peptide } } , 1551 inst { 1552 repr raw , 1553 mol aa , 1554 length 12 , 1555 seq-data 1556 iupacaa "AATTGGCCAANN" } , 1557 annot { 1558 { 1559 data 1560 ftable { 1561 { 1562 data 1563 gene { 1564 locus "gene should not be on protein" } , 1565 location 1566 int { 1567 from 0 , 1568 to 12 , 1569 strand plus , 1570 id 1571 local 1572 str "pop3_prot" } } } } } } } } } } , 1573 set { 1574 class pop-set , 1575 seq-set { 1576 seq { 1577 id { 1578 local 1579 str "pop4" } , 1580 descr { 1581 molinfo { 1582 biomol genomic } } , 1583 inst { 1584 repr raw , 1585 mol dna , 1586 length 12 , 1587 seq-data 1588 iupacna "AATTGGCCAANN" } } , 1589 seq { 1590 id { 1591 local 1592 str "pop5" } , 1593 descr { 1594 molinfo { 1595 biomol genomic } } , 1596 inst { 1597 repr raw , 1598 mol dna , 1599 length 12 , 1600 seq-data 1601 iupacna "AATTGGCCAANN" } } , 1602 set { 1603 class nuc-prot , 1604 seq-set { 1605 seq { 1606 id { 1607 local 1608 str "pop6" } , 1609 descr { 1610 molinfo { 1611 biomol genomic } } , 1612 inst { 1613 repr raw , 1614 mol dna , 1615 length 12 , 1616 seq-data 1617 iupacna "AATTGGCCAANN" } } , 1618 seq { 1619 id { 1620 local 1621 str "pop6_prot" } , 1622 descr { 1623 molinfo { 1624 biomol peptide } } , 1625 inst { 1626 repr raw , 1627 mol aa , 1628 length 12 , 1629 seq-data 1630 iupacaa "AATTGGCCAANN" } } } } } } , 1631 set { 1632 class genbank , 1633 seq-set { 1634 seq { 1635 id { 1636 local 1637 str "pkg5" } , 1638 descr { 1639 molinfo { 1640 biomol genomic } } , 1641 inst { 1642 repr raw , 1643 mol dna , 1644 length 12 , 1645 seq-data 1646 iupacna "AATTGGCCAANN" } } , 1647 seq { 1648 id { 1649 local 1650 str "pkg6" } , 1651 descr { 1652 molinfo { 1653 biomol genomic } } , 1654 inst { 1655 repr raw , 1656 mol dna , 1657 length 12 , 1658 seq-data 1659 iupacna "AATTGGCCAANN" } } } } , 1660 seq { 1661 id { 1662 gi 123456 } , 1663 inst { 1664 repr raw , 1665 mol dna , 1666 length 16 , 1667 seq-data 1668 iupacna "AATTGGCCAATTGGCC" , 1669 hist { 1670 replaced-by { 1671 date 1672 std { 1673 year 2004 , 1674 month 2 , 1675 day 26 } , 1676 ids { 1677 gi 123456 } } } } } , 1678 seq { 1679 id { 1680 tpg { 1681 accession "BD000024" , 1682 version 1 } } , 1683 inst { 1684 repr raw , 1685 mol dna , 1686 length 18 , 1687 seq-data 1688 iupacna "AATTGGCCAATTGGCCNN" } } , 1689 seq { 1690 id { 1691 genbank { 1692 accession "BD000022" , 1693 version 1 } , 1694 genbank { 1695 accession "BD000023" , 1696 version 1 } , 1697 gi 1 } , 1698 descr { 1699 genbank { 1700 extra-accessions { 1701 "BD000022" , 1702 "BD000023" } } , 1703 embl { 1704 creation-date 1705 std { 1706 year 1980 , 1707 month 1 , 1708 day 1 } , 1709 update-date 1710 std { 1711 year 1980 , 1712 month 1 , 1713 day 1 } , 1714 extra-acc { 1715 "BD000022" , 1716 "BD000023" } } } , 1717 inst { 1718 repr raw , 1719 mol dna , 1720 length 16 , 1721 seq-data 1722 iupacna "AATTGGCCAATTGGCC" } } , 1723 set { 1724 class nuc-prot , 1725 seq-set { 1726 seq { 1727 id { 1728 local 1729 str "np1" } , 1730 inst { 1731 repr raw , 1732 mol dna , 1733 length 16 , 1734 seq-data 1735 iupacna "AATTGGCCAATTGGCC" } } , 1736 seq { 1737 id { 1738 local 1739 str "np1_prot" } , 1740 descr { 1741 title "An instantiated protein title" } , 1742 inst { 1743 repr raw , 1744 mol aa , 1745 length 5 , 1746 seq-data 1747 ncbieaa "LMMLP" } } } , 1748 annot { 1749 { 1750 data 1751 ftable { 1752 { 1753 data 1754 cdregion { 1755 orf TRUE , 1756 code { 1757 id 1 } } , 1758 product 1759 whole 1760 local 1761 str "np1_prot" , 1762 location 1763 int { 1764 from 0 , 1765 to 875 , 1766 strand plus , 1767 id 1768 local 1769 str "np1" } } } } } } , 1770 set { 1771 class nuc-prot , 1772 seq-set { 1773 seq { 1774 id { 1775 local 1776 str "np2" } , 1777 descr { 1778 source { 1779 org { 1780 taxname "not a mergeable taxname" } } } , 1781 inst { 1782 repr raw , 1783 mol dna , 1784 length 16 , 1785 seq-data 1786 iupacna "AATTGGCCAATTGGCC" } } , 1787 seq { 1788 id { 1789 local 1790 str "np2_prot" } , 1791 descr { 1792 title "An instantiated protein title" , 1793 source { 1794 org { 1795 taxname "a taxname for a protein" , 1796 db { 1797 { 1798 db "database1" , 1799 tag 1800 str "foo" } , 1801 { 1802 db "database1" , 1803 tag 1804 str "bar" } } } } } , 1805 inst { 1806 repr raw , 1807 mol aa , 1808 length 5 , 1809 seq-data 1810 ncbieaa "LMMLP" } } } , 1811 annot { 1812 { 1813 data 1814 ftable { 1815 { 1816 data 1817 cdregion { 1818 code { 1819 id 1 } } , 1820 product 1821 whole 1822 local 1823 str "np2_prot" , 1824 location 1825 int { 1826 from 0 , 1827 to 875 , 1828 strand plus , 1829 id 1830 local 1831 str "np2" } } } } } } , 1832 set { 1833 class nuc-prot , 1834 seq-set { 1835 seq { 1836 id { 1837 local 1838 str "np3" } , 1839 inst { 1840 repr raw , 1841 mol dna , 1842 length 16 , 1843 seq-data 1844 iupacna "AATTGGCCAATTGGCC" } } , 1845 seq { 1846 id { 1847 local 1848 str "np5" } , 1849 inst { 1850 repr raw , 1851 mol dna , 1852 length 16 , 1853 seq-data 1854 iupacna "AATTGGCCAATTGGCC" } } , 1855 seq { 1856 id { 1857 local 1858 str "np3_prot" } , 1859 descr { 1860 title "An instantiated protein title" } , 1861 inst { 1862 repr raw , 1863 mol aa , 1864 length 5 , 1865 seq-data 1866 ncbieaa "LMMLP" } } } } , 1867 set { 1868 class nuc-prot , 1869 seq-set { 1870 seq { 1871 id { 1872 local 1873 str "np4" } , 1874 inst { 1875 repr raw , 1876 mol dna , 1877 length 16 , 1878 seq-data 1879 iupacna "AATTGGCCAATTGGCC" } } } } , 1880 set { 1881 class nuc-prot , 1882 seq-set { 1883 seq { 1884 id { 1885 local 1886 str "np4_prot" } , 1887 descr { 1888 title "An instantiated protein title" } , 1889 inst { 1890 repr raw , 1891 mol aa , 1892 length 5 , 1893 seq-data 1894 ncbieaa "LMMLP" } } } } , 1895 set { 1896 class gen-prod-set , 1897 seq-set { 1898 seq { 1899 id { 1900 local 1901 str "gps1" } , 1902 inst { 1903 repr delta , 1904 mol dna , 1905 length 120 , 1906 ext 1907 delta { 1908 literal { 1909 length 10 , 1910 seq-data 1911 iupacna "AATTGGCCAA" } , 1912 literal { 1913 length 100 , 1914 fuzz 1915 lim unk } , 1916 literal { 1917 length 10 , 1918 seq-data 1919 iupacna "AATTGGCCAA" } } } , 1920 annot { 1921 { 1922 data 1923 ftable { 1924 { 1925 data 1926 rna { 1927 type mRNA , 1928 ext 1929 name "misplaced" } , 1930 product 1931 whole 1932 local 1933 str "seq_not_here" , 1934 location 1935 int { 1936 from 0 , 1937 to 9 , 1938 strand plus , 1939 id 1940 local 1941 str "gps1" } } } } } } , 1942 set { 1943 class nuc-prot , 1944 seq-set { 1945 seq { 1946 id { 1947 local 1948 str "gps2" } , 1949 inst { 1950 repr raw , 1951 mol rna , 1952 length 10 , 1953 seq-data 1954 iupacaa "AATTGGCCAA" } } , 1955 seq { 1956 id { 1957 local 1958 str "gps2_prot" } , 1959 inst { 1960 repr raw , 1961 mol aa , 1962 length 10 , 1963 seq-data 1964 iupacaa "AATTGGCCAA" } } } } } , 1965 annot { 1966 { 1967 data 1968 ftable { 1969 { 1970 data 1971 rna { 1972 type rRNA , 1973 ext 1974 name "misplaced" } , 1975 location 1976 int { 1977 from 0 , 1978 to 548 , 1979 strand plus , 1980 id 1981 genbank { 1982 accession "EZ000163" , 1983 version 1 } } } } } } } , 1984 set { 1985 class gen-prod-set , 1986 seq-set { 1987 seq { 1988 id { 1989 local 1990 str "gps3" } , 1991 inst { 1992 repr delta , 1993 mol dna , 1994 length 120 , 1995 ext 1996 delta { 1997 literal { 1998 length 10 , 1999 seq-data 2000 iupacna "AATTGGCCAA" } , 2001 literal { 2002 length 100 , 2003 fuzz 2004 lim unk } , 2005 literal { 2006 length 10 , 2007 seq-data 2008 iupacna "AATTGGCCAA" } } } , 2009 annot { 2010 { 2011 data 2012 ftable { 2013 { 2014 data 2015 gene { 2016 locus "gps_gene" } , 2017 location 2018 int { 2019 from 0 , 2020 to 9 , 2021 strand plus , 2022 id 2023 local 2024 str "gps3" } } , 2025 { 2026 data 2027 rna { 2028 type mRNA , 2029 ext 2030 name "misplaced" } , 2031 product 2032 whole 2033 local 2034 str "gps4" , 2035 location 2036 int { 2037 from 0 , 2038 to 9 , 2039 strand plus , 2040 id 2041 local 2042 str "gps3" } } } } } } , 2043 set { 2044 class nuc-prot , 2045 seq-set { 2046 seq { 2047 id { 2048 local 2049 str "gps4" } , 2050 inst { 2051 repr raw , 2052 mol rna , 2053 length 10 , 2054 seq-data 2055 iupacna "AAUUGGCCAA" } , 2056 annot { 2057 { 2058 data 2059 ftable { 2060 { 2061 data 2062 gene { 2063 locus "gps_gene_not_match" } , 2064 location 2065 int { 2066 from 0 , 2067 to 9 , 2068 strand plus , 2069 id 2070 local 2071 str "gps4" } } , 2072 { 2073 data 2074 cdregion { 2075 } , 2076 product 2077 whole 2078 local 2079 str "gps4_prot" , 2080 location 2081 int { 2082 from 0 , 2083 to 9 , 2084 strand plus , 2085 id 2086 local 2087 str "gps4" } } } } } } , 2088 seq { 2089 id { 2090 local 2091 str "gps4_prot" } , 2092 inst { 2093 repr raw , 2094 mol aa , 2095 length 10 , 2096 seq-data 2097 iupacaa "AATTGGCCAA" } } } } } } , 2098 seq { 2099 id { 2100 local 2101 str "feat1_prot" } , 2102 inst { 2103 repr raw , 2104 mol aa , 2105 length 10 , 2106 seq-data 2107 iupacaa "AATTGGCCAA" } , 2108 annot { 2109 { 2110 data 2111 ftable { 2112 { 2113 data 2114 cdregion { 2115 } , 2116 location 2117 int { 2118 from 0 , 2119 to 9 , 2120 strand plus , 2121 id 2122 local 2123 str "feat1_prot" } } , 2124 { 2125 data 2126 rna { 2127 type rRNA , 2128 ext 2129 name "misplaced" } , 2130 location 2131 int { 2132 from 0 , 2133 to 9 , 2134 strand minus , 2135 id 2136 local 2137 str "feat1_prot" } } , 2138 { 2139 data 2140 rsite 2141 str "foo" , 2142 location 2143 int { 2144 from 0 , 2145 to 9 , 2146 strand plus , 2147 id 2148 local 2149 str "feat1_prot" } } , 2150 { 2151 data 2152 txinit { 2153 name "txinit should not be on prot" , 2154 txsystem unknown } , 2155 location 2156 int { 2157 from 0 , 2158 to 9 , 2159 strand plus , 2160 id 2161 local 2162 str "feat1_prot" } } , 2163 { 2164 data 2165 gene { 2166 locus "gene should not be on prot" } , 2167 location 2168 int { 2169 from 0 , 2170 to 9 , 2171 strand plus , 2172 id 2173 local 2174 str "feat1_prot" } } } } } } , 2175 seq { 2176 id { 2177 local 2178 str "feat1_nuc" } , 2179 inst { 2180 repr raw , 2181 mol dna , 2182 length 10 , 2183 seq-data 2184 iupacaa "AATTGGCCAA" } , 2185 annot { 2186 { 2187 data 2188 ftable { 2189 { 2190 data 2191 prot { 2192 } , 2193 location 2194 int { 2195 from 0 , 2196 to 9 , 2197 strand plus , 2198 id 2199 local 2200 str "feat1_nuc" } } , 2201 { 2202 data 2203 psec-str helix , 2204 location 2205 int { 2206 from 0 , 2207 to 9 , 2208 strand plus , 2209 id 2210 local 2211 str "feat1_nuc" } } , 2212 { 2213 data 2214 imp { 2215 key "mat_peptide" } , 2216 location 2217 int { 2218 from 0 , 2219 to 9 , 2220 strand plus , 2221 id 2222 local 2223 str "feat1_nuc" } } , 2224 { 2225 data 2226 imp { 2227 key "sig_peptide" } , 2228 location 2229 int { 2230 from 0 , 2231 to 9 , 2232 strand plus , 2233 id 2234 local 2235 str "feat1_nuc" } } , 2236 { 2237 data 2238 imp { 2239 key "transit_peptide" } , 2240 location 2241 int { 2242 from 0 , 2243 to 9 , 2244 strand plus , 2245 id 2246 local 2247 str "feat1_nuc" } } , 2248 { 2249 data 2250 imp { 2251 key "preprotein" } , 2252 location 2253 int { 2254 from 0 , 2255 to 9 , 2256 strand plus , 2257 id 2258 local 2259 str "feat1_nuc" } } , 2260 { 2261 data 2262 imp { 2263 key "proprotein" } , 2264 location 2265 int { 2266 from 0 , 2267 to 9 , 2268 strand plus , 2269 id 2270 local 2271 str "feat1_nuc" } } , 2272 { 2273 data 2274 imp { 2275 key "mRNA" } , 2276 location 2277 int { 2278 from 0 , 2279 to 9 , 2280 strand plus , 2281 id 2282 local 2283 str "feat1_nuc" } } , 2284 { 2285 data 2286 imp { 2287 key "tRNA" } , 2288 location 2289 int { 2290 from 0 , 2291 to 9 , 2292 strand plus , 2293 id 2294 local 2295 str "feat1_nuc" } } , 2296 { 2297 data 2298 imp { 2299 key "rRNA" } , 2300 location 2301 int { 2302 from 0 , 2303 to 9 , 2304 strand plus , 2305 id 2306 local 2307 str "feat1_nuc" } } , 2308 { 2309 data 2310 imp { 2311 key "snRNA" } , 2312 location 2313 int { 2314 from 0 , 2315 to 9 , 2316 strand plus , 2317 id 2318 local 2319 str "feat1_nuc" } } , 2320 { 2321 data 2322 imp { 2323 key "scRNA" } , 2324 location 2325 int { 2326 from 0 , 2327 to 9 , 2328 strand plus , 2329 id 2330 local 2331 str "feat1_nuc" } } , 2332 { 2333 data 2334 imp { 2335 key "snoRNA" } , 2336 location 2337 int { 2338 from 0 , 2339 to 9 , 2340 strand plus , 2341 id 2342 local 2343 str "feat1_nuc" } } , 2344 { 2345 data 2346 imp { 2347 key "misc_RNA" } , 2348 location 2349 int { 2350 from 0 , 2351 to 9 , 2352 strand plus , 2353 id 2354 local 2355 str "feat1_nuc" } } , 2356 { 2357 data 2358 imp { 2359 key "precursor_RNA" } , 2360 location 2361 int { 2362 from 0 , 2363 to 9 , 2364 strand plus , 2365 id 2366 local 2367 str "feat1_nuc" } } } } } } , 2368 seq { 2369 id { 2370 local 2371 str "feat1_mrna" } , 2372 descr { 2373 molinfo { 2374 biomol mRNA } } , 2375 inst { 2376 repr raw , 2377 mol rna , 2378 length 20 , 2379 seq-data 2380 iupacaa "AATTGGCCAAAATTGGCCAA" } , 2381 annot { 2382 { 2383 data 2384 ftable { 2385 { 2386 data 2387 rna { 2388 type mRNA , 2389 ext 2390 name "no mRNA on mRNA seq" } , 2391 location 2392 int { 2393 from 0 , 2394 to 9 , 2395 strand plus , 2396 id 2397 local 2398 str "feat1_mrna" } } , 2399 { 2400 data 2401 imp { 2402 key "CAAT_signal" } , 2403 location 2404 int { 2405 from 0 , 2406 to 9 , 2407 strand plus , 2408 id 2409 local 2410 str "feat1_mrna" } , 2411 qual { 2412 { 2413 qual "replace" , 2414 val "AATTGGCCAA" } , 2415 { 2416 qual "phenotype" , 2417 val "inappropriate qual for CAAT_signal" } } } , 2418 { 2419 data 2420 cdregion { 2421 } , 2422 location 2423 mix { 2424 int { 2425 from 0 , 2426 to 3 , 2427 strand plus , 2428 id 2429 local 2430 str "feat1_mrna" } , 2431 int { 2432 from 6 , 2433 to 9 , 2434 strand plus , 2435 id 2436 local 2437 str "feat1_mrna" } } , 2438 pseudo TRUE } , 2439 { 2440 data 2441 cdregion { 2442 } , 2443 location 2444 mix { 2445 int { 2446 from 0 , 2447 to 3 , 2448 strand plus , 2449 id 2450 local 2451 str "feat1_mrna" } , 2452 int { 2453 from 6 , 2454 to 9 , 2455 strand plus , 2456 id 2457 local 2458 str "feat1_mrna" } } } } } } } , 2459 seq { 2460 id { 2461 local 2462 str "feat1_prerna" } , 2463 descr { 2464 molinfo { 2465 biomol pre-RNA } } , 2466 inst { 2467 repr raw , 2468 mol rna , 2469 length 10 , 2470 seq-data 2471 iupacaa "AATTGGCCAA" } , 2472 annot { 2473 { 2474 data 2475 ftable { 2476 { 2477 data 2478 imp { 2479 key "CAAT_signal" } , 2480 location 2481 int { 2482 from 0 , 2483 to 9 , 2484 strand plus , 2485 id 2486 local 2487 str "feat1_prerna" } } } } } } , 2488 set { 2489 class nuc-prot , 2490 descr { 2491 source { 2492 genome genomic , 2493 org { 2494 taxname " Acanthamoeba:: castellanii ,,," , 2495 common " some;; common name.~~;, " , 2496 mod { 2497 " a;;b ;,;, " , 2498 " c::d ;,;,. " } , 2499 syn { 2500 " a;;b ;,;, " , 2501 " c::d ;,;,. " } , 2502 orgname { 2503 attrib " a;;b ;,;, " , 2504 mod { 2505 { 2506 subtype acronym , 2507 subname " a;;b ;,;, " } , 2508 { 2509 subtype authority , 2510 subname " c::d ;,;,;. " } } , 2511 lineage " a;;b ;,;,. " , 2512 div " c::d ;,;,;, " } } , 2513 subtype { 2514 { 2515 subtype country , 2516 name "wonderland" } , 2517 { 2518 subtype chromosome , 2519 name "1:2" } , 2520 { 2521 subtype chromosome , 2522 name " a::b ,,,;;; " } } } , 2523 pub { 2524 pub { 2525 patent { 2526 title "This is a patent without authors. It should not trigger 2527 a validator error." , 2528 authors { 2529 names 2530 str { 2531 "?" } } , 2532 country "USA" , 2533 doc-type "document type" } } } , 2534 pub { 2535 pub { 2536 gen { 2537 cit "This is a cit-gen without authors. It should trigger a 2538 validator error." , 2539 authors { 2540 names 2541 str { 2542 "?" } } , 2543 serial-number 42 , 2544 title "This is a cit-gen without authors. It should trigger a 2545 validator error." } } } , 2546 pub { 2547 pub { 2548 sub { 2549 authors { 2550 names 2551 std { 2552 { 2553 name 2554 name { 2555 last " Bollin " , 2556 first " Colleen " , 2557 initials " C.J. " } } } } } } } , 2558 pub { 2559 pub { 2560 gen { 2561 cit "Unpublished" , 2562 authors { 2563 names 2564 std { 2565 { 2566 name 2567 name { 2568 last " Bollin " , 2569 first " Colleen " , 2570 initials " C.J. " } } } , 2571 affil 2572 std { 2573 affil "<applet" , 2574 div " dept " , 2575 city " city " , 2576 sub " state " , 2577 country " country " , 2578 street " address " , 2579 email " email " , 2580 fax " fax " , 2581 phone " phone " , 2582 postal-code " code " } } , 2583 serial-number 42 , 2584 title " one unpublished pub " } } , 2585 name " pubdesc has a name;,;, " , 2586 comment " pubdesc;; has a comment;,;, " } } , 2587 seq-set { 2588 seq { 2589 id { 2590 genbank { 2591 accession "EZ000163" , 2592 version 1 } } , 2593 descr { 2594 genbank { 2595 extra-accessions { 2596 " a::b;,~ " , 2597 " c;;d;,;,. " , 2598 " c;d " , 2599 " a;;b;,~ " } , 2600 source " a::b;,~ " , 2601 keywords { 2602 " a::b;,~ " , 2603 " c;;d;,;, " , 2604 " c;d " , 2605 " a;;b;,~ " } , 2606 origin " a;;b~;, " , 2607 date " a,,b,~; " , 2608 div " a~~b " , 2609 taxonomy " a b " } , 2610 embl { 2611 creation-date 2612 std { 2613 year 1980 , 2614 month 1 , 2615 day 1 } , 2616 update-date 2617 std { 2618 year 1980 , 2619 month 1 , 2620 day 1 } , 2621 extra-acc { 2622 " a;;b;,;,. " , 2623 " c::d;,;, " } } , 2624 title " (578 - :: 1126) ,,; " , 2625 region " (578 - :: 1126) ,,; " , 2626 molinfo { 2627 biomol genomic , 2628 tech htgs-1 } , 2629 create-date 2630 std { 2631 year 2008 , 2632 month 12 , 2633 day 5 } , 2634 name " foo;a ,;~ " } , 2635 inst { 2636 repr raw , 2637 mol dna , 2638 length 549 , 2639 seq-data 2640 ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE337E3 2641FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CFE30 264270D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0CFF3 26433A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H } , 2644 annot { 2645 { 2646 data 2647 ftable { 2648 { 2649 data 2650 rna { 2651 type rRNA , 2652 ext 2653 name " fo::o~,; " } , 2654 location 2655 int { 2656 from 0 , 2657 to 548 , 2658 strand plus , 2659 id 2660 genbank { 2661 accession "EZ000163" , 2662 version 1 } } } , 2663 { 2664 data 2665 gene { 2666 locus " fo;;o~,; " , 2667 allele " ba,,r.,~; " , 2668 desc " waka,~,;. " , 2669 maploc " zip;;zip~,; " , 2670 syn { 2671 " a;;b;,;,; " , 2672 " c::d;,;,;,. " } , 2673 locus-tag " a;;b " } , 2674 comment " comm;;ent;,~ " , 2675 location 2676 int { 2677 from 0 , 2678 to 548 , 2679 strand plus , 2680 id 2681 genbank { 2682 accession "EZ000163" , 2683 version 1 } } , 2684 qual { 2685 { 2686 qual "satellite" , 2687 val " unknown;;value ;,;~~" } , 2688 { 2689 qual " bad;;kname;,;, " , 2690 val " weird;;value;.,.;., " } } , 2691 title " tit;;le ;,;,; " , 2692 except-text " except;;text,;,, " } , 2693 { 2694 data 2695 region " zip;;py,;~ " , 2696 location 2697 int { 2698 from 0 , 2699 to 548 , 2700 strand plus , 2701 id 2702 genbank { 2703 accession "EZ000163" , 2704 version 1 } } , 2705 dbxref { 2706 { 2707 db " a::b,;~ " , 2708 tag 2709 str " c;;d;~, " } } } , 2710 { 2711 data 2712 imp { 2713 key " bad;;keyname;,;, " , 2714 loc " has;; loc;,;, " , 2715 descr " descr;,;,; " } , 2716 location 2717 int { 2718 from 0 , 2719 to 548 , 2720 strand plus , 2721 id 2722 genbank { 2723 accession "EZ000163" , 2724 version 1 } } } , 2725 { 2726 data 2727 pub { 2728 pub { 2729 gen { 2730 cit "Unpublished" , 2731 authors { 2732 names 2733 std { 2734 { 2735 name 2736 name { 2737 last " Bollin " , 2738 first " Colleen " , 2739 initials " C.J. " } } } , 2740 affil 2741 std { 2742 affil " inst " , 2743 div " dept " , 2744 city " city " , 2745 sub " state " , 2746 country " country " , 2747 street " address " , 2748 email " email " , 2749 fax " fax " , 2750 phone " phone " , 2751 postal-code " code " } } , 2752 title " one unpublished pub " } } , 2753 name " pubdesc has a name;,;, " , 2754 comment " pubdesc;; has a comment;,;, " } , 2755 comment "additional comment for pub feature" , 2756 location 2757 int { 2758 from 0 , 2759 to 548 , 2760 strand plus , 2761 id 2762 genbank { 2763 accession "EZ000163" , 2764 version 1 } } } , 2765 { 2766 data 2767 cdregion { 2768 code { 2769 id 1 } } , 2770 product 2771 whole 2772 local 2773 str "EZ000163_1" , 2774 location 2775 int { 2776 from 0 , 2777 to 548 , 2778 strand plus , 2779 id 2780 genbank { 2781 accession "EZ000163" , 2782 version 1 } } } } } } } , 2783 seq { 2784 id { 2785 local 2786 str "EZ000163_1" } , 2787 inst { 2788 repr raw , 2789 mol aa , 2790 length 183 , 2791 seq-data 2792 ncbieaa "-IVLKDFV*FNLFNVSVTLVNRGSV*VRK**GFDILICLFGS*ACWCCLYYSWSV 2793GWIYRFRFKFVDTFKFL*SLL*TYSL*GI*LFDN*SRYSNDFFF*CLF**VVLVNIFFRFF*V*VI*LCLV*IL*VFE 2794*WFLQYFIWN*VCIMDLVLVGLFIHLCLL*LLLVLVWIT*CSLYILLVYL" } , 2795 annot { 2796 { 2797 data 2798 ftable { 2799 { 2800 data 2801 prot { 2802 name { 2803 " foo;;bar;,;,. " , 2804 " bar::foo;,;,; " } , 2805 desc " prot;;desc;,;, " , 2806 ec { 2807 " 1;;2::3,,4,;,;, " , 2808 " 5;;6::7,,8;,;,,. " } , 2809 activity { 2810 " activ;;ity1;,;, " , 2811 " activ;;ity2;,;,. " } } , 2812 location 2813 int { 2814 from 0 , 2815 to 182 , 2816 id 2817 local 2818 str "EZ000163_1" } } } } } } } } , 2819 set { 2820 class nuc-prot , 2821 seq-set { 2822 seq { 2823 id { 2824 local 2825 str "np_feat_nuc" } , 2826 inst { 2827 repr raw , 2828 mol dna , 2829 length 16 , 2830 seq-data 2831 iupacna "AATTGGCCAATTGGCC" } } , 2832 seq { 2833 id { 2834 local 2835 str "np_feat_prot" } , 2836 descr { 2837 molinfo { 2838 completeness complete } } , 2839 inst { 2840 repr raw , 2841 mol aa , 2842 length 5 , 2843 seq-data 2844 ncbieaa "LMMLP" } } , 2845 seq { 2846 id { 2847 local 2848 str "np_feat_prot2" } , 2849 descr { 2850 molinfo { 2851 completeness complete } } , 2852 inst { 2853 repr raw , 2854 mol aa , 2855 length 5 , 2856 seq-data 2857 ncbieaa "LMMLP" } } , 2858 seq { 2859 id { 2860 local 2861 str "np_feat_prot3" } , 2862 descr { 2863 molinfo { 2864 completeness complete } } , 2865 inst { 2866 repr raw , 2867 mol aa , 2868 length 5 , 2869 seq-data 2870 ncbieaa "LMMLP" } } } , 2871 annot { 2872 { 2873 data 2874 ftable { 2875 { 2876 data 2877 cdregion { 2878 code { 2879 id 1 } } , 2880 product 2881 whole 2882 local 2883 str "np_feat_prot" , 2884 location 2885 int { 2886 from 0 , 2887 to 15 , 2888 strand plus , 2889 id 2890 local 2891 str "np_feat_nuc" , 2892 fuzz-to 2893 lim gt } } , 2894 { 2895 data 2896 cdregion { 2897 code { 2898 id 1 } , 2899 code-break { 2900 { 2901 loc 2902 int { 2903 from 20 , 2904 to 30 , 2905 strand plus , 2906 id 2907 local 2908 str "np_feat_nuc" } , 2909 aa 2910 ncbieaa 27 } } } , 2911 product 2912 whole 2913 local 2914 str "np_feat_prot2" , 2915 location 2916 int { 2917 from 0 , 2918 to 15 , 2919 strand plus , 2920 id 2921 local 2922 str "np_feat_nuc" , 2923 fuzz-from 2924 lim lt } } , 2925 { 2926 data 2927 cdregion { 2928 code { 2929 id 1 } } , 2930 product 2931 whole 2932 local 2933 str "np_feat_prot3" , 2934 location 2935 int { 2936 from 0 , 2937 to 15 , 2938 strand plus , 2939 id 2940 local 2941 str "np_feat_nuc" , 2942 fuzz-from 2943 lim lt , 2944 fuzz-to 2945 lim gt } } , 2946 { 2947 data 2948 rna { 2949 type tRNA , 2950 ext 2951 tRNA { 2952 anticodon 2953 mix { 2954 int { 2955 from 20 , 2956 to 25 , 2957 strand plus , 2958 id 2959 local 2960 str "np_feat_nuc" } , 2961 int { 2962 from 25 , 2963 to 30 , 2964 strand minus , 2965 id 2966 local 2967 str "np_feat_nuc" } } } } , 2968 location 2969 mix { 2970 int { 2971 from 0 , 2972 to 3 , 2973 strand plus , 2974 id 2975 local 2976 str "np_feat_nuc" } , 2977 int { 2978 from 6 , 2979 to 9 , 2980 strand minus , 2981 id 2982 local 2983 str "np_feat_nuc" } } } , 2984 { 2985 data 2986 rna { 2987 type tRNA , 2988 ext 2989 tRNA { 2990 anticodon 2991 mix { 2992 int { 2993 from 20 , 2994 to 25 , 2995 strand plus , 2996 id 2997 local 2998 str "np_feat_nuc" } , 2999 int { 3000 from 25 , 3001 to 30 , 3002 id 3003 local 3004 str "np_feat_nuc" } } } } , 3005 location 3006 mix { 3007 int { 3008 from 0 , 3009 to 3 , 3010 strand plus , 3011 id 3012 local 3013 str "np_feat_nuc" } , 3014 int { 3015 from 6 , 3016 to 9 , 3017 id 3018 local 3019 str "np_feat_nuc" } } } } } } } , 3020 set { 3021 class nuc-prot , 3022 seq-set { 3023 seq { 3024 id { 3025 local 3026 str "np_feat2_nuc" } , 3027 inst { 3028 repr raw , 3029 mol dna , 3030 length 16 , 3031 seq-data 3032 iupacna "AATTGGCCAATTGGCC" } } , 3033 seq { 3034 id { 3035 local 3036 str "np_feat2_prot" } , 3037 descr { 3038 molinfo { 3039 completeness no-left } } , 3040 inst { 3041 repr raw , 3042 mol aa , 3043 length 5 , 3044 seq-data 3045 ncbieaa "LMMLP" } } } , 3046 annot { 3047 { 3048 data 3049 ftable { 3050 { 3051 data 3052 cdregion { 3053 code { 3054 id 1 } } , 3055 product 3056 whole 3057 local 3058 str "np_feat2_prot" , 3059 location 3060 int { 3061 from 0 , 3062 to 15 , 3063 strand plus , 3064 id 3065 local 3066 str "np_feat2_nuc" , 3067 fuzz-to 3068 lim gt } } } } } } , 3069 set { 3070 class nuc-prot , 3071 seq-set { 3072 seq { 3073 id { 3074 local 3075 str "np_feat3_nuc" } , 3076 inst { 3077 repr raw , 3078 mol dna , 3079 length 16 , 3080 seq-data 3081 iupacna "AATTGGCCAATTGGCC" } } , 3082 seq { 3083 id { 3084 local 3085 str "np_feat3_prot" } , 3086 descr { 3087 molinfo { 3088 completeness no-right } } , 3089 inst { 3090 repr raw , 3091 mol aa , 3092 length 5 , 3093 seq-data 3094 ncbieaa "LMMLP" } } } , 3095 annot { 3096 { 3097 data 3098 ftable { 3099 { 3100 data 3101 cdregion { 3102 code { 3103 id 1 } } , 3104 product 3105 whole 3106 local 3107 str "np_feat3_prot" , 3108 location 3109 int { 3110 from 0 , 3111 to 15 , 3112 strand plus , 3113 id 3114 local 3115 str "np_feat3_nuc" , 3116 fuzz-from 3117 lim lt } } } } } } , 3118 set { 3119 class nuc-prot , 3120 seq-set { 3121 seq { 3122 id { 3123 local 3124 str "np_feat4_nuc" } , 3125 inst { 3126 repr raw , 3127 mol dna , 3128 length 16 , 3129 seq-data 3130 iupacna "AATTGGCCAATTGGCC" } } , 3131 seq { 3132 id { 3133 local 3134 str "np_feat4_prot1" } , 3135 descr { 3136 molinfo { 3137 completeness no-ends } } , 3138 inst { 3139 repr raw , 3140 mol aa , 3141 length 5 , 3142 seq-data 3143 ncbieaa "LMMLP" } } , 3144 seq { 3145 id { 3146 local 3147 str "np_feat4_prot2" } , 3148 descr { 3149 molinfo { 3150 completeness no-ends } } , 3151 inst { 3152 repr raw , 3153 mol aa , 3154 length 5 , 3155 seq-data 3156 ncbieaa "LMMLP" } } , 3157 seq { 3158 id { 3159 local 3160 str "np_feat4_prot3" } , 3161 descr { 3162 molinfo { 3163 completeness no-ends } } , 3164 inst { 3165 repr raw , 3166 mol aa , 3167 length 4 , 3168 seq-data 3169 ncbieaa "LMML" } } } , 3170 annot { 3171 { 3172 data 3173 ftable { 3174 { 3175 data 3176 cdregion { 3177 code { 3178 id 1 } } , 3179 product 3180 whole 3181 local 3182 str "np_feat4_prot1" , 3183 location 3184 int { 3185 from 0 , 3186 to 15 , 3187 strand plus , 3188 id 3189 local 3190 str "np_feat4_nuc" , 3191 fuzz-from 3192 lim lt } } , 3193 { 3194 data 3195 cdregion { 3196 code { 3197 id 1 } } , 3198 product 3199 whole 3200 local 3201 str "np_feat4_prot2" , 3202 location 3203 int { 3204 from 0 , 3205 to 15 , 3206 strand plus , 3207 id 3208 local 3209 str "np_feat4_nuc" , 3210 fuzz-to 3211 lim gt } } , 3212 { 3213 data 3214 cdregion { 3215 code { 3216 id 1 } } , 3217 product 3218 whole 3219 local 3220 str "np_feat4_prot3" , 3221 location 3222 int { 3223 from 0 , 3224 to 15 , 3225 strand plus , 3226 id 3227 local 3228 str "np_feat4_nuc" } } } } } } , 3229 seq { 3230 id { 3231 other { 3232 accession "NT_123456" } } , 3233 inst { 3234 repr raw , 3235 mol dna , 3236 length 187 , 3237 seq-data 3238 iupacna "ATGAAATTTGGGCCCAAATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCAAACCCAA 3239AATGAAATTTGGGCCCAAATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCAAACCCAAAATGAAATTTGGGCCCAA 3240ATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCAAACCCAAAAAAAAAA" } , 3241 annot { 3242 { 3243 data 3244 ftable { 3245 { 3246 data 3247 cdregion { 3248 code { 3249 id 1 } } , 3250 comment "cds on NT_ sequence without product should not 3251 produce error" , 3252 location 3253 int { 3254 from 0 , 3255 to 186 , 3256 strand plus , 3257 id 3258 other { 3259 accession "NT_123456" } } } } } } } , 3260 seq { 3261 id { 3262 other { 3263 accession "NG_123456" } } , 3264 inst { 3265 repr raw , 3266 mol dna , 3267 length 186 , 3268 seq-data 3269 ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7ABB82644 3270586A862264CA3A67FC8C7D4B7D63BEE3648'H } , 3271 annot { 3272 { 3273 data 3274 ftable { 3275 { 3276 data 3277 cdregion { 3278 code { 3279 id 1 } } , 3280 comment "cds on NG_ sequence without product should not 3281 produce error" , 3282 location 3283 int { 3284 from 0 , 3285 to 186 , 3286 strand plus , 3287 id 3288 other { 3289 accession "NG_123456" } } } } } } } , 3290 seq { 3291 id { 3292 other { 3293 accession "NW_123456" } } , 3294 inst { 3295 repr raw , 3296 mol dna , 3297 length 187 , 3298 seq-data 3299 ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7ABB82644 3300586A862264CA3A67FC8C7D4B7D63BEE3648'H } , 3301 annot { 3302 { 3303 data 3304 ftable { 3305 { 3306 data 3307 cdregion { 3308 code { 3309 id 1 } } , 3310 comment "cds on NW_ sequence without product should not 3311 produce error" , 3312 location 3313 int { 3314 from 0 , 3315 to 186 , 3316 strand plus , 3317 id 3318 other { 3319 accession "NW_123456" } } } } } } } , 3320 seq { 3321 id { 3322 local 3323 str "feat2" } , 3324 inst { 3325 repr raw , 3326 mol dna , 3327 length 187 , 3328 seq-data 3329 ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7ABB82644 3330586A862264CA3A67FC8C7D4B7D63BEE3648'H } , 3331 annot { 3332 { 3333 data 3334 ftable { 3335 { 3336 data 3337 gene { 3338 } , 3339 location 3340 int { 3341 from 0 , 3342 to 30 , 3343 strand plus , 3344 id 3345 local 3346 str "feat2" } } , 3347 { 3348 data 3349 rna { 3350 type unknown , 3351 ext 3352 name "misplaced" } , 3353 location 3354 int { 3355 from 0 , 3356 to 186 , 3357 strand plus , 3358 id 3359 local 3360 str "feat2" } } , 3361 { 3362 data 3363 imp { 3364 key "not recognized" } , 3365 location 3366 int { 3367 from 0 , 3368 to 186 , 3369 strand plus , 3370 id 3371 local 3372 str "feat2" } , 3373 qual { 3374 { 3375 qual "not recognized" , 3376 val "something" } , 3377 { 3378 qual "" , 3379 val "null qual name" } } } , 3380 { 3381 data 3382 imp { 3383 key "conflict" } , 3384 location 3385 int { 3386 from 0 , 3387 to 548 , 3388 strand plus , 3389 id 3390 local 3391 str "feat2" } } , 3392 { 3393 data 3394 imp { 3395 key "gap" } , 3396 location 3397 int { 3398 from 0 , 3399 to 186 , 3400 strand plus , 3401 id 3402 local 3403 str "feat2" } } , 3404 { 3405 data 3406 imp { 3407 key "misc_binding" } , 3408 location 3409 int { 3410 from 0 , 3411 to 548 , 3412 strand plus , 3413 id 3414 local 3415 str "feat2" } } , 3416 { 3417 data 3418 imp { 3419 key "modified_base" } , 3420 location 3421 int { 3422 from 0 , 3423 to 548 , 3424 strand plus , 3425 id 3426 local 3427 str "feat2" } } , 3428 { 3429 data 3430 imp { 3431 key "old_sequence" } , 3432 location 3433 int { 3434 from 0 , 3435 to 548 , 3436 strand plus , 3437 id 3438 local 3439 str "feat2" } } , 3440 { 3441 data 3442 imp { 3443 key "operon" } , 3444 location 3445 int { 3446 from 0 , 3447 to 548 , 3448 strand plus , 3449 id 3450 local 3451 str "feat2" } } , 3452 { 3453 data 3454 imp { 3455 key "protein_bind" } , 3456 location 3457 int { 3458 from 0 , 3459 to 548 , 3460 strand plus , 3461 id 3462 local 3463 str "feat2" } } , 3464 { 3465 data 3466 imp { 3467 key "protein_bind" } , 3468 location 3469 int { 3470 from 0 , 3471 to 548 , 3472 strand plus , 3473 id 3474 local 3475 str "feat2" } } , 3476 { 3477 data 3478 gene { 3479 } , 3480 location 3481 mix { 3482 int { 3483 from 0 , 3484 to 4 , 3485 strand plus , 3486 id 3487 local 3488 str "badinst1" } , 3489 int { 3490 from 5 , 3491 to 9 , 3492 strand plus , 3493 id 3494 genbank { 3495 accession "M65061.1" } } } } , 3496 { 3497 data 3498 cdregion { 3499 } , 3500 product 3501 whole 3502 local 3503 str "seq_not_present" , 3504 location 3505 int { 3506 from 0 , 3507 to 186 , 3508 strand plus , 3509 id 3510 local 3511 str "feat2" } , 3512 pseudo TRUE } , 3513 { 3514 data 3515 cdregion { 3516 code { 3517 id 1 } } , 3518 comment "This should produce an error" , 3519 location 3520 int { 3521 from 0 , 3522 to 186 , 3523 strand plus , 3524 id 3525 local 3526 str "feat2" } , 3527 qual { 3528 { 3529 qual "transl_except" , 3530 val "unparseable foo" } , 3531 { 3532 qual "exception" , 3533 val "unparseable exception qual" } } } } } } } , 3534 seq { 3535 id { 3536 local 3537 str "feat3" } , 3538 inst { 3539 repr raw , 3540 mol dna , 3541 length 187 , 3542 seq-data 3543 ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7ABB82644 3544586A862264CA3A67FC8C7D4B7D63BEE3648'H } , 3545 annot { 3546 { 3547 data 3548 ftable { 3549 { 3550 data 3551 rna { 3552 type tRNA , 3553 ext 3554 tRNA { 3555 aa 3556 iupacaa 1 , 3557 codon { 3558 0 , 3559 1 , 3560 2 } , 3561 anticodon 3562 int { 3563 from 5 , 3564 to 7 , 3565 strand plus , 3566 id 3567 local 3568 str "feat3" } } } , 3569 location 3570 int { 3571 from 0 , 3572 to 186 , 3573 strand plus , 3574 id 3575 local 3576 str "feat3" } } , 3577 { 3578 data 3579 rna { 3580 type tRNA , 3581 ext 3582 tRNA { 3583 aa 3584 iupacaa 1 , 3585 codon { 3586 0 , 3587 1 , 3588 2 } , 3589 anticodon 3590 int { 3591 from 5 , 3592 to 7 , 3593 strand plus , 3594 id 3595 local 3596 str "feat3" } } } , 3597 except TRUE , 3598 location 3599 int { 3600 from 50 , 3601 to 186 , 3602 strand plus , 3603 id 3604 local 3605 str "feat3" } , 3606 except-text "RNA editing" } , 3607 { 3608 data 3609 imp { 3610 key "misc_feature" } , 3611 comment "strands: both, both-rev" , 3612 location 3613 mix { 3614 int { 3615 from 0 , 3616 to 3 , 3617 strand both , 3618 id 3619 local 3620 str "feat3" } , 3621 int { 3622 from 6 , 3623 to 9 , 3624 strand both-rev , 3625 id 3626 local 3627 str "feat3" } } } , 3628 { 3629 data 3630 imp { 3631 key "misc_feature" } , 3632 comment "strands: both, both" , 3633 location 3634 mix { 3635 int { 3636 from 0 , 3637 to 3 , 3638 strand both , 3639 id 3640 local 3641 str "feat3" } , 3642 int { 3643 from 6 , 3644 to 9 , 3645 strand both , 3646 id 3647 local 3648 str "feat3" } } } , 3649 { 3650 data 3651 imp { 3652 key "misc_feature" } , 3653 comment "strands: both-rev, both-rev" , 3654 location 3655 mix { 3656 int { 3657 from 0 , 3658 to 3 , 3659 strand both-rev , 3660 id 3661 local 3662 str "feat3" } , 3663 int { 3664 from 6 , 3665 to 9 , 3666 strand both-rev , 3667 id 3668 local 3669 str "feat3" } } } , 3670 { 3671 data 3672 gene { 3673 locus "redundant" } , 3674 location 3675 int { 3676 from 0 , 3677 to 186 , 3678 strand plus , 3679 id 3680 local 3681 str "feat3" } } , 3682 { 3683 data 3684 cdregion { 3685 code-break { 3686 { 3687 loc 3688 int { 3689 from 1 , 3690 to 3 , 3691 strand plus , 3692 id 3693 local 3694 str "feat3" } , 3695 aa 3696 ncbieaa 27 } } } , 3697 location 3698 int { 3699 from 0 , 3700 to 186 , 3701 strand plus , 3702 id 3703 local 3704 str "feat3" } , 3705 xref { 3706 { 3707 data 3708 gene { 3709 locus "redundant" } } } } } } } } , 3710 set { 3711 class gibb , 3712 seq-set { 3713 } } , 3714 set { 3715 class nuc-prot , 3716 seq-set { 3717 set { 3718 class phy-set , 3719 seq-set { 3720 } } } } , 3721 set { 3722 class parts , 3723 seq-set { 3724 seq { 3725 id { 3726 local 3727 str "pkg3" } , 3728 inst { 3729 repr raw , 3730 mol dna , 3731 length 10 , 3732 seq-data 3733 iupacna "AATTGGCCAA" } , 3734 annot { 3735 { 3736 data 3737 ftable { 3738 { 3739 data 3740 rna { 3741 type rRNA , 3742 ext 3743 name "misplaced" } , 3744 location 3745 int { 3746 from 0 , 3747 to 548 , 3748 strand plus , 3749 id 3750 genbank { 3751 accession "EZ000163" , 3752 version 1 } } } } } } } , 3753 seq { 3754 id { 3755 local 3756 str "pkg4" } , 3757 inst { 3758 repr raw , 3759 mol aa , 3760 length 10 , 3761 seq-data 3762 iupacaa "AATTGGCCAA" } } , 3763 set { 3764 class parts , 3765 seq-set { 3766 } } } } , 3767 set { 3768 class nuc-prot , 3769 seq-set { 3770 seq { 3771 id { 3772 local 3773 str "np_feat5" } , 3774 descr { 3775 molinfo { 3776 biomol genomic } } , 3777 inst { 3778 repr raw , 3779 mol dna , 3780 length 24 , 3781 seq-data 3782 iupacna "AATTGGCCAANNAATTGGCCAANN" } , 3783 annot { 3784 { 3785 data 3786 ftable { 3787 { 3788 data 3789 imp { 3790 key "repeat_region" } , 3791 location 3792 int { 3793 from 0 , 3794 to 5 , 3795 strand plus , 3796 id 3797 local 3798 str "np_feat5" } , 3799 qual { 3800 { 3801 qual "rpt_unit_seq" , 3802 val "aa" } } } , 3803 { 3804 data 3805 imp { 3806 key "repeat_region" } , 3807 location 3808 int { 3809 from 0 , 3810 to 5 , 3811 strand plus , 3812 id 3813 local 3814 str "np_feat5" } , 3815 qual { 3816 { 3817 qual "rpt_unit_seq" , 3818 val "gggg" } } } , 3819 { 3820 data 3821 imp { 3822 key "mat_peptide" } , 3823 location 3824 int { 3825 from 1 , 3826 to 3 , 3827 strand plus , 3828 id 3829 local 3830 str "np_feat5" } , 3831 qual { 3832 { 3833 qual "product" , 3834 val "this mat_peptide is not on a codon boundary" } } } , 3835 { 3836 data 3837 imp { 3838 key "repeat_region" } , 3839 location 3840 int { 3841 from 0 , 3842 to 5 , 3843 strand plus , 3844 id 3845 local 3846 str "np_feat5" } , 3847 qual { 3848 { 3849 qual "rpt_unit_seq" , 3850 val "zzzzzz" } , 3851 { 3852 qual "rpt_unit_range" , 3853 val "bad value" } , 3854 { 3855 qual "rpt_unit_range" , 3856 val "50..60" } , 3857 { 3858 qual "rpt_unit_seq" , 3859 val "12345" } } } } } } } , 3860 seq { 3861 id { 3862 local 3863 str "np_feat5_prot" } , 3864 descr { 3865 molinfo { 3866 biomol peptide } } , 3867 inst { 3868 repr raw , 3869 mol aa , 3870 length 24 , 3871 seq-data 3872 iupacaa "AATTGGCCAANNAATTGGCCTTCC" } , 3873 annot { 3874 { 3875 data 3876 ftable { 3877 { 3878 data 3879 prot { 3880 name { 3881 "overlap1" } , 3882 processed signal-peptide } , 3883 location 3884 int { 3885 from 0 , 3886 to 5 , 3887 strand plus , 3888 id 3889 local 3890 str "np_feat5_prot" } } , 3891 { 3892 data 3893 prot { 3894 name { 3895 "overlap2" } , 3896 processed mature } , 3897 location 3898 int { 3899 from 4 , 3900 to 12 , 3901 strand plus , 3902 id 3903 local 3904 str "np_feat5_prot" } } } } } } } , 3905 annot { 3906 { 3907 data 3908 ftable { 3909 { 3910 data 3911 imp { 3912 key "variation" } , 3913 location 3914 int { 3915 from 0 , 3916 to 5 , 3917 strand plus , 3918 id 3919 local 3920 str "np_feat5" } , 3921 qual { 3922 { 3923 qual "replace" , 3924 val "AATTGG" } } } , 3925 { 3926 data 3927 cdregion { 3928 } , 3929 comment "[12346]" , 3930 product 3931 whole 3932 local 3933 str "np_feat5_prot" , 3934 location 3935 int { 3936 from 0 , 3937 to 5 , 3938 strand plus , 3939 id 3940 local 3941 str "np_feat5" } } , 3942 { 3943 data 3944 imp { 3945 key "mat_peptide" } , 3946 location 3947 int { 3948 from 1 , 3949 to 2 , 3950 strand plus , 3951 id 3952 local 3953 str "np_feat5" } } , 3954 { 3955 data 3956 imp { 3957 key "sig_peptide" } , 3958 location 3959 int { 3960 from 0 , 3961 to 3 , 3962 strand plus , 3963 id 3964 local 3965 str "np_feat5" } } , 3966 { 3967 data 3968 imp { 3969 key "transit_peptide" } , 3970 location 3971 int { 3972 from 1 , 3973 to 3 , 3974 strand plus , 3975 id 3976 local 3977 str "np_feat5" } } , 3978 { 3979 data 3980 cdregion { 3981 frame two } , 3982 comment "[12346]" , 3983 product 3984 whole 3985 local 3986 str "np_feat5_prot" , 3987 location 3988 int { 3989 from 6 , 3990 to 10 , 3991 strand plus , 3992 id 3993 local 3994 str "np_feat5" } } , 3995 { 3996 data 3997 imp { 3998 key "mat_peptide" } , 3999 location 4000 int { 4001 from 6 , 4002 to 9 , 4003 strand plus , 4004 id 4005 local 4006 str "np_feat5" } } , 4007 { 4008 data 4009 imp { 4010 key "sig_peptide" } , 4011 location 4012 int { 4013 from 7 , 4014 to 8 , 4015 strand plus , 4016 id 4017 local 4018 str "np_feat5" } } , 4019 { 4020 data 4021 imp { 4022 key "transit_peptide" } , 4023 location 4024 int { 4025 from 6 , 4026 to 8 , 4027 strand plus , 4028 id 4029 local 4030 str "np_feat5" } } , 4031 { 4032 data 4033 cdregion { 4034 frame three } , 4035 comment "[12346]" , 4036 product 4037 whole 4038 local 4039 str "np_feat5_prot" , 4040 location 4041 int { 4042 from 11 , 4043 to 15 , 4044 strand plus , 4045 id 4046 local 4047 str "np_feat5" } } , 4048 { 4049 data 4050 imp { 4051 key "mat_peptide" } , 4052 location 4053 int { 4054 from 12 , 4055 to 15 , 4056 strand plus , 4057 id 4058 local 4059 str "np_feat5" } } , 4060 { 4061 data 4062 imp { 4063 key "sig_peptide" } , 4064 location 4065 int { 4066 from 13 , 4067 to 14 , 4068 strand plus , 4069 id 4070 local 4071 str "np_feat5" } } , 4072 { 4073 data 4074 imp { 4075 key "transit_peptide" } , 4076 location 4077 int { 4078 from 12 , 4079 to 14 , 4080 strand plus , 4081 id 4082 local 4083 str "np_feat5" } } , 4084 { 4085 data 4086 cdregion { 4087 frame two } , 4088 comment "[12346]" , 4089 product 4090 whole 4091 local 4092 str "np_feat5_prot" , 4093 location 4094 int { 4095 from 16 , 4096 to 20 , 4097 strand plus , 4098 id 4099 local 4100 str "np_feat5" , 4101 fuzz-from 4102 lim lt , 4103 fuzz-to 4104 lim gt } } , 4105 { 4106 data 4107 imp { 4108 key "mat_peptide" } , 4109 location 4110 int { 4111 from 18 , 4112 to 20 , 4113 strand plus , 4114 id 4115 local 4116 str "np_feat5" , 4117 fuzz-to 4118 lim gt } } , 4119 { 4120 data 4121 imp { 4122 key "sig_peptide" } , 4123 location 4124 int { 4125 from 16 , 4126 to 18 , 4127 strand plus , 4128 id 4129 local 4130 str "np_feat5" , 4131 fuzz-from 4132 lim lt } } , 4133 { 4134 data 4135 imp { 4136 key "transit_peptide" } , 4137 location 4138 int { 4139 from 18 , 4140 to 18 , 4141 strand plus , 4142 id 4143 local 4144 str "np_feat5" } } , 4145 { 4146 data 4147 cdregion { 4148 } , 4149 comment "[12345]" , 4150 product 4151 whole 4152 local 4153 str "np_feat5_prot" , 4154 location 4155 int { 4156 from 0 , 4157 to 5 , 4158 strand plus , 4159 id 4160 local 4161 str "np_feat5" } } } } } } , 4162 set { 4163 class genbank , 4164 seq-set { 4165 seq { 4166 id { 4167 local 4168 str "mrna_1" } , 4169 descr { 4170 molinfo { 4171 biomol genomic } } , 4172 inst { 4173 repr raw , 4174 mol dna , 4175 length 24 , 4176 seq-data 4177 iupacna "AATTGGCCAANNAATTGGCCAANN" } , 4178 annot { 4179 { 4180 data 4181 ftable { 4182 { 4183 data 4184 gene { 4185 locus "bad mrna gene1" } , 4186 location 4187 int { 4188 from 0 , 4189 to 5 , 4190 strand plus , 4191 id 4192 local 4193 str "mrna_1" } } , 4194 { 4195 data 4196 rna { 4197 type mRNA , 4198 ext 4199 name "an mRNA feature" } , 4200 product 4201 whole 4202 local 4203 str "mrna_2" , 4204 location 4205 int { 4206 from 0 , 4207 to 5 , 4208 strand plus , 4209 id 4210 local 4211 str "mrna_1" } } , 4212 { 4213 data 4214 gene { 4215 locus "bad mrna gene1" } , 4216 location 4217 int { 4218 from 10 , 4219 to 15 , 4220 strand plus , 4221 id 4222 local 4223 str "mrna_1" } } , 4224 { 4225 data 4226 rna { 4227 type mRNA , 4228 ext 4229 name "an mRNA feature" } , 4230 product 4231 whole 4232 local 4233 str "mrna_2" , 4234 location 4235 int { 4236 from 10 , 4237 to 15 , 4238 strand plus , 4239 id 4240 local 4241 str "mrna_1" } } , 4242 { 4243 data 4244 gene { 4245 locus "bad mrna gene3" } , 4246 location 4247 int { 4248 from 16 , 4249 to 20 , 4250 strand plus , 4251 id 4252 local 4253 str "mrna_1" } } , 4254 { 4255 data 4256 rna { 4257 type mRNA , 4258 ext 4259 name "an mRNA feature" } , 4260 product 4261 whole 4262 local 4263 str "mrna_2" , 4264 location 4265 int { 4266 from 18 , 4267 to 23 , 4268 strand plus , 4269 id 4270 local 4271 str "mrna_1" } } , 4272 { 4273 data 4274 imp { 4275 key "polyA_site" } , 4276 location 4277 mix { 4278 int { 4279 from 18 , 4280 to 20 , 4281 strand plus , 4282 id 4283 local 4284 str "mrna_1" } , 4285 int { 4286 from 21 , 4287 to 23 , 4288 strand plus , 4289 id 4290 local 4291 str "mrna_1" } } , 4292 cit 4293 pub { 4294 equiv { 4295 gen { 4296 cit "blah" } , 4297 gen { 4298 cit "foo" } } } } , 4299 { 4300 data 4301 imp { 4302 key "polyA_signal" } , 4303 location 4304 int { 4305 from 18 , 4306 to 18 , 4307 strand plus , 4308 id 4309 local 4310 str "mrna_1" } } , 4311 { 4312 data 4313 cdregion { 4314 } , 4315 product 4316 whole 4317 local 4318 str "mrna_2" , 4319 location 4320 mix { 4321 int { 4322 from 12 , 4323 to 20 , 4324 strand plus , 4325 id 4326 local 4327 str "mrna_1" } , 4328 int { 4329 from 12 , 4330 to 20 , 4331 strand plus , 4332 id 4333 local 4334 str "mrna_1" } } } } } } } , 4335 seq { 4336 id { 4337 local 4338 str "gene_1" } , 4339 inst { 4340 repr raw , 4341 mol rna , 4342 length 24 , 4343 seq-data 4344 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } , 4345 annot { 4346 { 4347 data 4348 ftable { 4349 { 4350 data 4351 gene { 4352 locus "gene2" } , 4353 product 4354 whole 4355 genbank { 4356 name "gene_product" , 4357 version 1 } , 4358 location 4359 int { 4360 from 0 , 4361 to 5 , 4362 strand plus , 4363 id 4364 local 4365 str "gene_1" } } , 4366 { 4367 data 4368 gene { 4369 locus "gene3" , 4370 locus-tag "bad locus tag" } , 4371 product 4372 whole 4373 local 4374 str "gene_1" , 4375 location 4376 int { 4377 from 0 , 4378 to 5 , 4379 strand plus , 4380 id 4381 local 4382 str "gene_1" } } , 4383 { 4384 data 4385 gene { 4386 locus "gene1" , 4387 locus-tag "bad locus tag" } , 4388 product 4389 whole 4390 genbank { 4391 name "EZ000163" , 4392 version 1 } , 4393 location 4394 mix { 4395 int { 4396 from 0 , 4397 to 5 , 4398 strand plus , 4399 id 4400 local 4401 str "gene_1" } , 4402 int { 4403 from 10 , 4404 to 15 , 4405 strand plus , 4406 id 4407 local 4408 str "gene_1" } } , 4409 qual { 4410 { 4411 qual "old_locus_tag" , 4412 val "bad locus tag" } , 4413 { 4414 qual "old_locus_tag" , 4415 val "multiple,old,locus-tags" } } } } } } } , 4416 seq { 4417 id { 4418 genbank { 4419 name "EZ000163" , 4420 version 1 } } , 4421 descr { 4422 molinfo { 4423 biomol genomic } } , 4424 inst { 4425 repr raw , 4426 mol rna , 4427 length 24 , 4428 seq-data 4429 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } } , 4430 seq { 4431 id { 4432 genbank { 4433 name "gene_product" , 4434 version 1 } } , 4435 descr { 4436 molinfo { 4437 biomol genomic } } , 4438 inst { 4439 repr raw , 4440 mol rna , 4441 length 24 , 4442 seq-data 4443 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } } , 4444 seq { 4445 id { 4446 local 4447 str "mrna_2" } , 4448 descr { 4449 molinfo { 4450 biomol genomic } } , 4451 inst { 4452 repr raw , 4453 mol rna , 4454 length 24 , 4455 seq-data 4456 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } } } } , 4457 set { 4458 class genbank , 4459 seq-set { 4460 seq { 4461 id { 4462 local 4463 str "mrna_4" } , 4464 descr { 4465 molinfo { 4466 biomol genomic } } , 4467 inst { 4468 repr raw , 4469 mol dna , 4470 length 24 , 4471 seq-data 4472 iupacna "AATTGGCCAANNAATTGGCCAANN" } , 4473 annot { 4474 { 4475 data 4476 ftable { 4477 { 4478 data 4479 rna { 4480 type mRNA , 4481 ext 4482 name "an mRNA feature with an exception" } , 4483 except TRUE , 4484 product 4485 whole 4486 local 4487 str "mrna_6" , 4488 location 4489 int { 4490 from 0 , 4491 to 5 , 4492 strand plus , 4493 id 4494 local 4495 str "mrna_4" } , 4496 except-text "transcribed product replaced" } , 4497 { 4498 data 4499 rna { 4500 type mRNA , 4501 ext 4502 name "an mRNA feature with an exception" } , 4503 except TRUE , 4504 product 4505 whole 4506 local 4507 str "mrna_6" , 4508 location 4509 int { 4510 from 0 , 4511 to 8 , 4512 strand plus , 4513 id 4514 local 4515 str "mrna_4" } , 4516 except-text "unclassified transcription discrepancy" } , 4517 { 4518 data 4519 rna { 4520 type mRNA , 4521 ext 4522 name "an mRNA feature with an exception" } , 4523 except TRUE , 4524 product 4525 whole 4526 local 4527 str "mrna_5" , 4528 location 4529 int { 4530 from 0 , 4531 to 5 , 4532 strand plus , 4533 id 4534 local 4535 str "mrna_4" } , 4536 except-text "RNA editing" } } } } } , 4537 seq { 4538 id { 4539 local 4540 str "mrna_5" } , 4541 descr { 4542 molinfo { 4543 biomol genomic } } , 4544 inst { 4545 repr raw , 4546 mol rna , 4547 length 6 , 4548 seq-data 4549 iupacna "AATTGG" } } , 4550 seq { 4551 id { 4552 local 4553 str "mrna_6" } , 4554 descr { 4555 molinfo { 4556 biomol genomic } } , 4557 inst { 4558 repr raw , 4559 mol rna , 4560 length 9 , 4561 seq-data 4562 iupacna "AATTGGCAC" } } } } , 4563 set { 4564 class genbank , 4565 seq-set { 4566 seq { 4567 id { 4568 local 4569 str "mrna_7" } , 4570 descr { 4571 molinfo { 4572 biomol genomic } } , 4573 inst { 4574 repr raw , 4575 mol dna , 4576 length 24 , 4577 seq-data 4578 iupacna "AATTGGCCAANNAATTGGCCAANN" } , 4579 annot { 4580 { 4581 data 4582 ftable { 4583 { 4584 data 4585 rna { 4586 type mRNA , 4587 ext 4588 name "an mRNA feature" } , 4589 product 4590 whole 4591 local 4592 str "mrna_8" , 4593 location 4594 int { 4595 from 0 , 4596 to 5 , 4597 strand plus , 4598 id 4599 local 4600 str "mrna_7" } } , 4601 { 4602 data 4603 rna { 4604 type mRNA , 4605 ext 4606 name "an mRNA feature" } , 4607 product 4608 whole 4609 local 4610 str "mrna_9" , 4611 location 4612 int { 4613 from 6 , 4614 to 11 , 4615 strand plus , 4616 id 4617 local 4618 str "mrna_7" } } } } } } , 4619 seq { 4620 id { 4621 local 4622 str "mrna_8" } , 4623 descr { 4624 molinfo { 4625 biomol genomic } } , 4626 inst { 4627 repr raw , 4628 mol rna , 4629 length 13 , 4630 seq-data 4631 iupacna "AATTGAAAAAAAA" } } , 4632 seq { 4633 id { 4634 local 4635 str "mrna_9" } , 4636 descr { 4637 molinfo { 4638 biomol genomic } } , 4639 inst { 4640 repr raw , 4641 mol rna , 4642 length 27 , 4643 seq-data 4644 iupacna "CCAANNAATAAAAAAAAAAAAAAAAAA" } } } } , 4645 set { 4646 class nuc-prot , 4647 seq-set { 4648 seq { 4649 id { 4650 local 4651 str "mrna_10" } , 4652 inst { 4653 repr raw , 4654 mol dna , 4655 length 24 , 4656 seq-data 4657 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 4658 annot { 4659 { 4660 data 4661 ftable { 4662 { 4663 data 4664 gene { 4665 locus "gene not overlapping anything" } , 4666 location 4667 int { 4668 from 16 , 4669 to 18 , 4670 strand plus , 4671 id 4672 local 4673 str "mrna_10" } } , 4674 { 4675 data 4676 imp { 4677 key "repeat_region" } , 4678 location 4679 int { 4680 from 19 , 4681 to 20 , 4682 strand plus , 4683 id 4684 local 4685 str "mrna_10" } } , 4686 { 4687 id 4688 local 4689 str "foo2" , 4690 data 4691 rna { 4692 type mRNA , 4693 ext 4694 name "overlap1" } , 4695 location 4696 int { 4697 from 0 , 4698 to 5 , 4699 strand plus , 4700 id 4701 local 4702 str "mrna_10" } } , 4703 { 4704 id 4705 local 4706 str "bar2" , 4707 data 4708 rna { 4709 type mRNA , 4710 ext 4711 name "overlap2" } , 4712 location 4713 int { 4714 from 0 , 4715 to 5 , 4716 strand plus , 4717 id 4718 local 4719 str "mrna_10" } , 4720 xref { 4721 { 4722 id 4723 local 4724 str "baz2" } } } , 4725 { 4726 data 4727 rna { 4728 type mRNA , 4729 ext 4730 name "overlap1" } , 4731 product 4732 whole 4733 local 4734 str "mrna_11" , 4735 location 4736 int { 4737 from 6 , 4738 to 10 , 4739 strand plus , 4740 id 4741 local 4742 str "mrna_10" } } , 4743 { 4744 data 4745 rna { 4746 type mRNA , 4747 ext 4748 name "overlap2" } , 4749 product 4750 whole 4751 local 4752 str "mrna_11" , 4753 location 4754 int { 4755 from 6 , 4756 to 10 , 4757 strand plus , 4758 id 4759 local 4760 str "mrna_10" } } } } } } } , 4761 annot { 4762 { 4763 data 4764 ftable { 4765 { 4766 id 4767 local 4768 str "baz2" , 4769 data 4770 cdregion { 4771 } , 4772 location 4773 int { 4774 from 0 , 4775 to 5 , 4776 strand plus , 4777 id 4778 local 4779 str "mrna_10" } , 4780 xref { 4781 { 4782 id 4783 local 4784 str "bar2" } } } , 4785 { 4786 id 4787 local 4788 id 8 , 4789 data 4790 cdregion { 4791 } , 4792 location 4793 int { 4794 from 6 , 4795 to 10 , 4796 strand plus , 4797 id 4798 local 4799 str "mrna_10" } } , 4800 { 4801 id 4802 local 4803 id 8 , 4804 data 4805 cdregion { 4806 } , 4807 location 4808 int { 4809 from 11 , 4810 to 15 , 4811 strand plus , 4812 id 4813 local 4814 str "mrna_10" } } , 4815 { 4816 id 4817 local 4818 id 8 , 4819 data 4820 cdregion { 4821 } , 4822 location 4823 int { 4824 from 19 , 4825 to 20 , 4826 strand plus , 4827 id 4828 local 4829 str "mrna_10" } } } } } } , 4830 set { 4831 class nuc-prot , 4832 seq-set { 4833 seq { 4834 id { 4835 local 4836 str "mrna_12" } , 4837 inst { 4838 repr raw , 4839 mol dna , 4840 length 48 , 4841 seq-data 4842 iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANN" } , 4843 annot { 4844 { 4845 data 4846 ftable { 4847 { 4848 data 4849 gene { 4850 locus "gene not overlapping anything" } , 4851 location 4852 int { 4853 from 0 , 4854 to 2 , 4855 strand plus , 4856 id 4857 local 4858 str "mrna_12" } } , 4859 { 4860 data 4861 rna { 4862 type mRNA , 4863 ext 4864 name "mrna not overlapping anything" } , 4865 location 4866 int { 4867 from 3 , 4868 to 5 , 4869 strand plus , 4870 id 4871 local 4872 str "mrna_12" } } } } } } } , 4873 annot { 4874 { 4875 data 4876 ftable { 4877 { 4878 data 4879 cdregion { 4880 } , 4881 location 4882 int { 4883 from 6 , 4884 to 8 , 4885 strand plus , 4886 id 4887 local 4888 str "mrna_12" } } , 4889 { 4890 data 4891 cdregion { 4892 } , 4893 location 4894 int { 4895 from 6 , 4896 to 8 , 4897 strand plus , 4898 id 4899 local 4900 str "mrna_12" } } , 4901 { 4902 data 4903 cdregion { 4904 } , 4905 location 4906 int { 4907 from 9 , 4908 to 11 , 4909 strand plus , 4910 id 4911 local 4912 str "mrna_12" } } , 4913 { 4914 data 4915 cdregion { 4916 } , 4917 location 4918 int { 4919 from 9 , 4920 to 11 , 4921 strand plus , 4922 id 4923 local 4924 str "mrna_12" } } , 4925 { 4926 data 4927 cdregion { 4928 } , 4929 location 4930 int { 4931 from 12 , 4932 to 14 , 4933 strand plus , 4934 id 4935 local 4936 str "mrna_12" } } , 4937 { 4938 data 4939 cdregion { 4940 } , 4941 location 4942 int { 4943 from 12 , 4944 to 14 , 4945 strand plus , 4946 id 4947 local 4948 str "mrna_12" } } , 4949 { 4950 data 4951 cdregion { 4952 } , 4953 location 4954 int { 4955 from 15 , 4956 to 17 , 4957 strand plus , 4958 id 4959 local 4960 str "mrna_12" } } , 4961 { 4962 data 4963 cdregion { 4964 } , 4965 location 4966 int { 4967 from 18 , 4968 to 20 , 4969 strand plus , 4970 id 4971 local 4972 str "mrna_12" } } , 4973 { 4974 data 4975 cdregion { 4976 } , 4977 location 4978 int { 4979 from 21 , 4980 to 23 , 4981 strand plus , 4982 id 4983 local 4984 str "mrna_12" } } , 4985 { 4986 data 4987 cdregion { 4988 } , 4989 location 4990 int { 4991 from 24 , 4992 to 26 , 4993 strand plus , 4994 id 4995 local 4996 str "mrna_12" } } , 4997 { 4998 data 4999 cdregion { 5000 } , 5001 location 5002 int { 5003 from 27 , 5004 to 29 , 5005 strand plus , 5006 id 5007 local 5008 str "mrna_12" } } } } } } , 5009 set { 5010 class genbank , 5011 seq-set { 5012 seq { 5013 id { 5014 local 5015 str "mrna_13" } , 5016 descr { 5017 molinfo { 5018 biomol genomic } } , 5019 inst { 5020 repr raw , 5021 mol dna , 5022 length 24 , 5023 seq-data 5024 iupacna "AATTGGCCAANNAATTGGCCAANN" } , 5025 annot { 5026 { 5027 data 5028 ftable { 5029 { 5030 data 5031 rna { 5032 type mRNA , 5033 ext 5034 name "an mRNA feature" } , 5035 except TRUE , 5036 product 5037 whole 5038 local 5039 str "mrna_14" , 5040 location 5041 int { 5042 from 0 , 5043 to 5 , 5044 strand plus , 5045 id 5046 local 5047 str "mrna_13" } , 5048 except-text "RNA editing" } } } } } , 5049 seq { 5050 id { 5051 local 5052 str "mrna_14" } , 5053 descr { 5054 molinfo { 5055 biomol genomic } } , 5056 inst { 5057 repr raw , 5058 mol rna , 5059 length 6 , 5060 seq-data 5061 iupacna "AATTGG" } } } } , 5062 seq { 5063 id { 5064 local 5065 str "trna_1" } , 5066 inst { 5067 repr raw , 5068 mol rna , 5069 length 24 , 5070 seq-data 5071 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } , 5072 annot { 5073 { 5074 data 5075 ftable { 5076 { 5077 data 5078 rna { 5079 type tRNA , 5080 ext 5081 tRNA { 5082 aa 5083 iupacaa 255 , 5084 codon { 5085 200 } , 5086 anticodon 5087 int { 5088 from 5 , 5089 to 7 , 5090 strand plus , 5091 id 5092 local 5093 str "feat3" } } } , 5094 location 5095 int { 5096 from 0 , 5097 to 5 , 5098 strand plus , 5099 id 5100 local 5101 str "trna_1" } } , 5102 { 5103 data 5104 rna { 5105 type tRNA , 5106 ext 5107 tRNA { 5108 aa 5109 iupacaa 200 , 5110 codon { 5111 100 } , 5112 anticodon 5113 int { 5114 from 5 , 5115 to 7 , 5116 strand plus , 5117 id 5118 local 5119 str "feat3" } } } , 5120 location 5121 int { 5122 from 0 , 5123 to 5 , 5124 strand plus , 5125 id 5126 local 5127 str "trna_1" } } } } } } , 5128 seq { 5129 id { 5130 local 5131 str "mrna_3" } , 5132 inst { 5133 repr raw , 5134 mol rna , 5135 length 24 , 5136 seq-data 5137 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } , 5138 annot { 5139 { 5140 data 5141 ftable { 5142 { 5143 data 5144 gene { 5145 locus "wrong number" } , 5146 location 5147 int { 5148 from 0 , 5149 to 23 , 5150 strand plus , 5151 id 5152 local 5153 str "mrna_3" } } , 5154 { 5155 data 5156 rna { 5157 type mRNA , 5158 ext 5159 name "wrong number" } , 5160 location 5161 int { 5162 from 0 , 5163 to 10 , 5164 strand plus , 5165 id 5166 local 5167 str "mrna_3" } } , 5168 { 5169 data 5170 rna { 5171 type mRNA , 5172 ext 5173 name "wrong number" } , 5174 location 5175 int { 5176 from 15 , 5177 to 20 , 5178 strand plus , 5179 id 5180 local 5181 str "mrna_3" } } , 5182 { 5183 data 5184 cdregion { 5185 } , 5186 location 5187 int { 5188 from 15 , 5189 to 20 , 5190 strand plus , 5191 id 5192 local 5193 str "mrna_3" } } } } } } , 5194 set { 5195 class nuc-prot , 5196 seq-set { 5197 seq { 5198 id { 5199 local 5200 str "cds_1" } , 5201 inst { 5202 repr raw , 5203 mol dna , 5204 length 24 , 5205 seq-data 5206 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 5207 annot { 5208 { 5209 data 5210 ftable { 5211 { 5212 data 5213 imp { 5214 key "5'UTR" } , 5215 location 5216 int { 5217 from 0 , 5218 to 5 , 5219 strand plus , 5220 id 5221 local 5222 str "cds_1" } } , 5223 { 5224 data 5225 cdregion { 5226 conflict TRUE , 5227 code-break { 5228 { 5229 loc 5230 int { 5231 from 0 , 5232 to 3 , 5233 strand plus , 5234 id 5235 local 5236 str "cds_1" } , 5237 aa 5238 ncbieaa 10 } , 5239 { 5240 loc 5241 int { 5242 from 0 , 5243 to 3 , 5244 strand plus , 5245 id 5246 local 5247 str "cds_1" } , 5248 aa 5249 ncbieaa 15 } } } , 5250 product 5251 whole 5252 local 5253 str "cds_1_prot1" , 5254 location 5255 int { 5256 from 7 , 5257 to 15 , 5258 strand plus , 5259 id 5260 local 5261 str "cds_1" } , 5262 except-text "RNA editing" } , 5263 { 5264 data 5265 cdregion { 5266 conflict TRUE } , 5267 product 5268 whole 5269 local 5270 str "cds_1_prot2" , 5271 location 5272 int { 5273 from 7 , 5274 to 15 , 5275 strand plus , 5276 id 5277 local 5278 str "cds_1" } } , 5279 { 5280 data 5281 imp { 5282 key "3'UTR" } , 5283 location 5284 int { 5285 from 19 , 5286 to 23 , 5287 strand plus , 5288 id 5289 local 5290 str "cds_1" } } } } } } , 5291 seq { 5292 id { 5293 local 5294 str "cds_1_prot1" } , 5295 inst { 5296 repr raw , 5297 mol aa , 5298 length 3 , 5299 seq-data 5300 iupacaa "MLI" } } , 5301 seq { 5302 id { 5303 local 5304 str "cds_1_prot2" } , 5305 inst { 5306 repr raw , 5307 mol aa , 5308 length 3 , 5309 seq-data 5310 iupacaa "RLI" } } } } , 5311 set { 5312 class nuc-prot , 5313 seq-set { 5314 seq { 5315 id { 5316 local 5317 str "cds_2" } , 5318 inst { 5319 repr raw , 5320 mol dna , 5321 length 26 , 5322 seq-data 5323 iupacna "AATGGCTTTAGCTATTTCTGAATAGA" } , 5324 annot { 5325 { 5326 data 5327 ftable { 5328 { 5329 data 5330 gene { 5331 locus "pseudogene" } , 5332 location 5333 int { 5334 from 1 , 5335 to 24 , 5336 strand plus , 5337 id 5338 local 5339 str "cds_2" } , 5340 pseudo TRUE } , 5341 { 5342 data 5343 cdregion { 5344 } , 5345 except TRUE , 5346 product 5347 whole 5348 local 5349 str "cds_2_prot1" , 5350 location 5351 int { 5352 from 1 , 5353 to 24 , 5354 strand plus , 5355 id 5356 local 5357 str "cds_2" } , 5358 pseudo TRUE } , 5359 { 5360 data 5361 cdregion { 5362 } , 5363 except TRUE , 5364 product 5365 whole 5366 local 5367 str "cds_2_prot1" , 5368 location 5369 int { 5370 from 1 , 5371 to 24 , 5372 strand plus , 5373 id 5374 local 5375 str "cds_2" } , 5376 except-text "unclassified translation discrepancy" } , 5377 { 5378 data 5379 cdregion { 5380 } , 5381 except TRUE , 5382 product 5383 whole 5384 local 5385 str "cds_2_prot1" , 5386 location 5387 int { 5388 from 1 , 5389 to 24 , 5390 strand plus , 5391 id 5392 local 5393 str "cds_2" } , 5394 except-text "mismatches in translation" } , 5395 { 5396 data 5397 cdregion { 5398 } , 5399 except TRUE , 5400 product 5401 whole 5402 local 5403 str "cds_2_prot1" , 5404 location 5405 int { 5406 from 1 , 5407 to 24 , 5408 strand plus , 5409 id 5410 local 5411 str "cds_2" } , 5412 except-text "artificial frameshift" } , 5413 { 5414 data 5415 cdregion { 5416 } , 5417 except TRUE , 5418 product 5419 whole 5420 local 5421 str "cds_2_prot1" , 5422 location 5423 int { 5424 from 1 , 5425 to 24 , 5426 strand plus , 5427 id 5428 local 5429 str "cds_2" } , 5430 except-text "rearrangement required for product" } , 5431 { 5432 data 5433 cdregion { 5434 } , 5435 except TRUE , 5436 product 5437 whole 5438 local 5439 str "cds_2_prot1" , 5440 location 5441 int { 5442 from 1 , 5443 to 24 , 5444 strand plus , 5445 id 5446 local 5447 str "cds_2" } , 5448 except-text "translated product replaced" } } } } } , 5449 seq { 5450 id { 5451 local 5452 str "cds_2_prot1" } , 5453 inst { 5454 repr raw , 5455 mol aa , 5456 length 7 , 5457 seq-data 5458 iupacaa "MALAISE" } } , 5459 seq { 5460 id { 5461 local 5462 str "cds_2_prot2" } , 5463 inst { 5464 repr raw , 5465 mol aa , 5466 length 3 , 5467 seq-data 5468 iupacaa "RLI" } } } } , 5469 set { 5470 class nuc-prot , 5471 seq-set { 5472 seq { 5473 id { 5474 gibbmt 5 } , 5475 inst { 5476 repr raw , 5477 mol dna , 5478 length 24 , 5479 seq-data 5480 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 5481 annot { 5482 { 5483 data 5484 ftable { 5485 { 5486 id 5487 local 5488 str "foo" , 5489 data 5490 rna { 5491 type mRNA , 5492 ext 5493 name "overlap1" } , 5494 location 5495 int { 5496 from 0 , 5497 to 23 , 5498 strand plus , 5499 id 5500 gibbmt 5 } } , 5501 { 5502 id 5503 local 5504 str "bar" , 5505 data 5506 rna { 5507 type mRNA , 5508 ext 5509 name "overlap2" } , 5510 location 5511 int { 5512 from 0 , 5513 to 23 , 5514 strand plus , 5515 id 5516 gibbmt 5 } } } } } } , 5517 seq { 5518 id { 5519 other { 5520 accession "will_not_match" } } , 5521 inst { 5522 repr raw , 5523 mol aa , 5524 length 3 , 5525 seq-data 5526 iupacaa "MLI" } , 5527 annot { 5528 { 5529 data 5530 ftable { 5531 { 5532 data 5533 prot { 5534 name { 5535 "hypothetical protein XP_123456]" } } , 5536 location 5537 int { 5538 from 0 , 5539 to 2 , 5540 strand plus , 5541 id 5542 other { 5543 accession "will_not_match" } } } } } } } } , 5544 annot { 5545 { 5546 data 5547 ftable { 5548 { 5549 id 5550 local 5551 str "baz" , 5552 data 5553 cdregion { 5554 } , 5555 product 5556 whole 5557 other { 5558 accession "will_not_match" } , 5559 location 5560 int { 5561 from 0 , 5562 to 23 , 5563 strand plus , 5564 id 5565 gibbmt 5 } } } } } } , 5566 seq { 5567 id { 5568 general { 5569 db "foo" , 5570 tag 5571 str "gene_2" } } , 5572 inst { 5573 repr raw , 5574 mol rna , 5575 length 24 , 5576 seq-data 5577 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } , 5578 annot { 5579 { 5580 data 5581 ftable { 5582 { 5583 data 5584 gene { 5585 locus-tag "won't match general ID" } , 5586 location 5587 int { 5588 from 0 , 5589 to 5 , 5590 strand plus , 5591 id 5592 general { 5593 db "foo" , 5594 tag 5595 str "gene_2" } } } } } } } , 5596 seq { 5597 id { 5598 local 5599 str "gene_3" } , 5600 descr { 5601 pub { 5602 pub { 5603 article { 5604 title { 5605 name "A conservative test of genetic drift in the 5606 endosymbiotic bacterium Buchnera: slightly delterious mutations in the 5607 chaperonin groEL" } , 5608 authors { 5609 names 5610 std { 5611 { 5612 name 5613 name { 5614 last "Herbeck" , 5615 first "Joshua" , 5616 initials "J.T." } } , 5617 { 5618 name 5619 name { 5620 last "Funk" , 5621 first "Daniel" , 5622 initials "D.J." } } , 5623 { 5624 name 5625 name { 5626 last "Degnan" , 5627 first "Patrick" , 5628 initials "P.H." } } , 5629 { 5630 name 5631 name { 5632 last "Wernegreen" , 5633 first "Jennifer" , 5634 initials "J.J." } } } , 5635 affil 5636 std { 5637 affil "Marine Biological Laboratory" , 5638 div "Josephine Bay Paul Center" , 5639 city "Woods Hole" , 5640 sub "MA" , 5641 country "USA" , 5642 street "7 MBL Street" , 5643 postal-code "02543" } } , 5644 from 5645 journal { 5646 title { 5647 iso-jta "Genetics" } , 5648 imp { 5649 date 5650 str "?" , 5651 prepub in-press } } } , 5652 pmid 1234 } } } , 5653 inst { 5654 repr raw , 5655 mol rna , 5656 length 24 , 5657 seq-data 5658 iupacna "AAUUGGCCAANNAAUUGGCCAANN" } , 5659 annot { 5660 { 5661 data 5662 ftable { 5663 { 5664 data 5665 gene { 5666 locus "A" } , 5667 location 5668 int { 5669 from 0 , 5670 to 5 , 5671 strand plus , 5672 id 5673 local 5674 str "gene_3" } , 5675 cit 5676 pub { 5677 muid 81077261 } } , 5678 { 5679 data 5680 gene { 5681 locus "B" } , 5682 location 5683 int { 5684 from 0 , 5685 to 5 , 5686 strand plus , 5687 id 5688 local 5689 str "gene_3" } , 5690 cit 5691 pub { 5692 pmid 81077261 , 5693 gen { 5694 cit "blah" } , 5695 gen { 5696 cit "Herbeck,J.T. (?) Genetics |ActogditebBsdmitcg" } } } , 5697 { 5698 data 5699 imp { 5700 key "misc_feature" } , 5701 location 5702 int { 5703 from 0 , 5704 to 5 , 5705 strand plus , 5706 id 5707 local 5708 str "gene_3" } } , 5709 { 5710 data 5711 gene { 5712 locus "B" } , 5713 location 5714 int { 5715 from 10 , 5716 to 15 , 5717 strand plus , 5718 id 5719 local 5720 str "gene_3" } } , 5721 { 5722 data 5723 gene { 5724 locus "B" } , 5725 location 5726 int { 5727 from 10 , 5728 to 15 , 5729 strand plus , 5730 id 5731 local 5732 str "gene_3" } } , 5733 { 5734 data 5735 imp { 5736 key "misc_feature" } , 5737 comment "nested seqlocmix" , 5738 location 5739 mix { 5740 mix { 5741 int { 5742 from 0 , 5743 to 3 , 5744 strand plus , 5745 id 5746 gi 2 } , 5747 int { 5748 from 5 , 5749 to 8 , 5750 strand plus , 5751 id 5752 local 5753 str "gene_3" } } , 5754 int { 5755 from 10 , 5756 to 15 , 5757 strand plus , 5758 id 5759 gi 2 } } } , 5760 { 5761 data 5762 imp { 5763 key "misc_feature" } , 5764 location 5765 int { 5766 from 10 , 5767 to 15 , 5768 strand plus , 5769 id 5770 local 5771 str "gene_3" } } } } } } , 5772 seq { 5773 id { 5774 local 5775 str "src_feat" } , 5776 inst { 5777 repr raw , 5778 mol dna , 5779 length 24 , 5780 seq-data 5781 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 5782 annot { 5783 { 5784 data 5785 ftable { 5786 { 5787 data 5788 pub { 5789 pub { 5790 gen { 5791 cit "This is a cit-gen with a bad date." , 5792 authors { 5793 names 5794 str { 5795 "An unstructured name" } } , 5796 date 5797 std { 5798 year 2038 , 5799 month 13 } , 5800 title "This is a cit-gen." } , 5801 pmid 6 } } , 5802 location 5803 int { 5804 from 0 , 5805 to 5 , 5806 strand plus , 5807 id 5808 local 5809 str "src_feat" } } , 5810 { 5811 data 5812 pub { 5813 pub { 5814 gen { 5815 cit "This is a cit-gen with a bad date." , 5816 authors { 5817 names 5818 str { 5819 "An unstructured name" } } , 5820 date 5821 std { 5822 year 2038 , 5823 month 13 } , 5824 title "This is a cit-gen." } , 5825 pmid 6 } } , 5826 location 5827 int { 5828 from 7 , 5829 to 15 , 5830 strand plus , 5831 id 5832 local 5833 str "src_feat" } } , 5834 { 5835 data 5836 biosrc { 5837 genome genomic , 5838 org { 5839 taxname "matches" , 5840 orgname { 5841 } } } , 5842 location 5843 int { 5844 from 0 , 5845 to 5 , 5846 strand plus , 5847 id 5848 local 5849 str "src_feat" } } , 5850 { 5851 data 5852 biosrc { 5853 genome genomic , 5854 org { 5855 taxname "matches" , 5856 orgname { 5857 } } } , 5858 location 5859 int { 5860 from 10 , 5861 to 15 , 5862 strand plus , 5863 id 5864 local 5865 str "src_feat" } } } } } } , 5866 seq { 5867 id { 5868 local 5869 str "src_feat2" } , 5870 inst { 5871 repr raw , 5872 mol dna , 5873 length 24 , 5874 seq-data 5875 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 5876 annot { 5877 { 5878 data 5879 ftable { 5880 { 5881 data 5882 pub { 5883 pub { 5884 gen { 5885 cit "This is a cit-gen with a bad date." , 5886 authors { 5887 names 5888 str { 5889 "An unstructured name" } } , 5890 date 5891 std { 5892 year 2038 , 5893 month 13 } , 5894 title "This is a cit-gen." } , 5895 pmid 6 } } , 5896 location 5897 int { 5898 from 0 , 5899 to 23 , 5900 strand plus , 5901 id 5902 local 5903 str "src_feat2" } } , 5904 { 5905 data 5906 pub { 5907 pub { 5908 gen { 5909 cit "This is a cit-gen with a bad date." , 5910 authors { 5911 names 5912 str { 5913 "An unstructured name" } } , 5914 date 5915 std { 5916 year 2038 , 5917 month 13 } , 5918 title "This is a cit-gen." } , 5919 pmid 6 } } , 5920 location 5921 int { 5922 from 0 , 5923 to 23 , 5924 strand plus , 5925 id 5926 local 5927 str "src_feat2" } } , 5928 { 5929 data 5930 biosrc { 5931 genome genomic , 5932 org { 5933 taxname "matches" , 5934 orgname { 5935 } } } , 5936 location 5937 int { 5938 from 0 , 5939 to 23 , 5940 strand plus , 5941 id 5942 local 5943 str "src_feat2" } } , 5944 { 5945 data 5946 biosrc { 5947 genome genomic , 5948 org { 5949 taxname "matches" , 5950 orgname { 5951 } } } , 5952 location 5953 int { 5954 from 0 , 5955 to 23 , 5956 strand plus , 5957 id 5958 local 5959 str "src_feat2" } } , 5960 { 5961 data 5962 biosrc { 5963 genome genomic , 5964 org { 5965 taxname "matches" , 5966 orgname { 5967 } } } , 5968 location 5969 int { 5970 from 0 , 5971 to 23 , 5972 strand plus , 5973 id 5974 local 5975 str "src_feat2" } } } } } } , 5976 seq { 5977 id { 5978 local 5979 str "redundant_fields" } , 5980 inst { 5981 repr raw , 5982 mol dna , 5983 length 24 , 5984 seq-data 5985 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 5986 annot { 5987 { 5988 data 5989 ftable { 5990 { 5991 data 5992 gene { 5993 locus "this matches comment" } , 5994 comment "this matches comment" , 5995 location 5996 bond { 5997 a { 5998 point 0 , 5999 strand plus , 6000 id 6001 local 6002 str "redundant_fields" } , 6003 b { 6004 point 3 , 6005 strand plus , 6006 id 6007 local 6008 str "redundant_fields" } } } , 6009 { 6010 data 6011 gene { 6012 locus-tag "this matches comment" } , 6013 comment "this matches comment" , 6014 location 6015 int { 6016 from 6 , 6017 to 10 , 6018 strand plus , 6019 id 6020 local 6021 str "redundant_fields" } } , 6022 { 6023 data 6024 gene { 6025 locus-tag "this matches old_locus_tag" } , 6026 location 6027 int { 6028 from 6 , 6029 to 10 , 6030 strand plus , 6031 id 6032 local 6033 str "redundant_fields" } , 6034 qual { 6035 { 6036 qual "old_locus_tag" , 6037 val "this matches old_locus_tag" } } } , 6038 { 6039 data 6040 het "heterogen feature 1" , 6041 location 6042 bond { 6043 a { 6044 point 0 , 6045 strand plus , 6046 id 6047 local 6048 str "redundant_fields" } , 6049 b { 6050 point 3 , 6051 strand plus , 6052 id 6053 local 6054 str "redundant_fields" } } , 6055 xref { 6056 { 6057 data 6058 gene { 6059 locus "will not find this locus" } } } } , 6060 { 6061 data 6062 het "heterogen feature 2" , 6063 location 6064 bond { 6065 a { 6066 point 0 , 6067 strand plus , 6068 id 6069 local 6070 str "redundant_fields" } } , 6071 xref { 6072 { 6073 data 6074 gene { 6075 locus-tag "will not find this locus-tag" } } } } , 6076 { 6077 data 6078 bond thioether , 6079 location 6080 bond { 6081 a { 6082 point 0 , 6083 strand plus , 6084 id 6085 local 6086 str "redundant_fields" } , 6087 b { 6088 point 3 , 6089 strand plus , 6090 id 6091 local 6092 str "redundant_fields" } } } , 6093 { 6094 data 6095 prot { 6096 name { 6097 "this matches comment" } } , 6098 comment "this matches comment" , 6099 location 6100 int { 6101 from 0 , 6102 to 5 , 6103 strand plus , 6104 id 6105 local 6106 str "redundant_fields" } } , 6107 { 6108 data 6109 prot { 6110 desc "this matches comment" } , 6111 comment "this matches comment" , 6112 location 6113 int { 6114 from 0 , 6115 to 5 , 6116 strand plus , 6117 id 6118 local 6119 str "redundant_fields" } } } } } } , 6120 set { 6121 class nuc-prot , 6122 seq-set { 6123 seq { 6124 id { 6125 local 6126 str "bad_xrefs" } , 6127 inst { 6128 repr raw , 6129 mol dna , 6130 length 24 , 6131 seq-data 6132 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 6133 annot { 6134 { 6135 data 6136 ftable { 6137 { 6138 id 6139 local 6140 id 1 , 6141 data 6142 gene { 6143 locus "gene for bad xrefs" } , 6144 location 6145 int { 6146 from 0 , 6147 to 5 , 6148 strand plus , 6149 id 6150 local 6151 str "bad_xrefs" } , 6152 xref { 6153 { 6154 id 6155 local 6156 id 2 } } } , 6157 { 6158 id 6159 local 6160 id 2 , 6161 data 6162 gene { 6163 locus "gene for bad xrefs" } , 6164 location 6165 int { 6166 from 0 , 6167 to 5 , 6168 strand plus , 6169 id 6170 local 6171 str "bad_xrefs" } , 6172 xref { 6173 { 6174 id 6175 local 6176 id 1 } } } , 6177 { 6178 id 6179 local 6180 id 6 , 6181 data 6182 cdregion { 6183 } , 6184 product 6185 whole 6186 gi 123457 , 6187 location 6188 int { 6189 from 0 , 6190 to 5 , 6191 strand plus , 6192 id 6193 local 6194 str "bad_xrefs" } , 6195 xref { 6196 { 6197 id 6198 local 6199 id 7 } } } , 6200 { 6201 id 6202 local 6203 id 7 , 6204 data 6205 rna { 6206 type mRNA , 6207 ext 6208 name "conflicting mrna" } , 6209 location 6210 int { 6211 from 0 , 6212 to 5 , 6213 strand plus , 6214 id 6215 local 6216 str "bad_xrefs" } , 6217 ext { 6218 type 6219 str "MrnaProteinLink" , 6220 data { 6221 { 6222 label 6223 str "protein seqID" , 6224 data 6225 str "gi|654321" } } } , 6226 xref { 6227 { 6228 id 6229 local 6230 id 6 } } } , 6231 { 6232 data 6233 gene { 6234 locus "gene for bad xrefs" } , 6235 location 6236 int { 6237 from 10 , 6238 to 15 , 6239 strand plus , 6240 id 6241 local 6242 str "bad_xrefs" } , 6243 xref { 6244 { 6245 id 6246 local 6247 id 5 } } } , 6248 { 6249 id 6250 local 6251 id 3 , 6252 data 6253 gene { 6254 locus "gene for bad xrefs" } , 6255 location 6256 int { 6257 from 10 , 6258 to 15 , 6259 strand plus , 6260 id 6261 local 6262 str "bad_xrefs" } , 6263 xref { 6264 { 6265 id 6266 local 6267 id 4 } } } , 6268 { 6269 id 6270 local 6271 id 4 , 6272 data 6273 gene { 6274 locus "gene for bad xrefs" } , 6275 location 6276 int { 6277 from 10 , 6278 to 15 , 6279 strand plus , 6280 id 6281 local 6282 str "bad_xrefs" } } } } } } , 6283 seq { 6284 id { 6285 gi 123457 } , 6286 inst { 6287 repr raw , 6288 mol aa , 6289 length 24 , 6290 seq-data 6291 iupacaa "AATTGGCATGTTAATTGGCCAANN" } } } } , 6292 seq { 6293 id { 6294 local 6295 str "gene_xrefs" } , 6296 inst { 6297 repr raw , 6298 mol dna , 6299 length 24 , 6300 seq-data 6301 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 6302 annot { 6303 { 6304 data 6305 ftable { 6306 { 6307 data 6308 gene { 6309 locus "match_on_locus" } , 6310 location 6311 int { 6312 from 0 , 6313 to 2 , 6314 strand plus , 6315 id 6316 local 6317 str "gene_xrefs" } } , 6318 { 6319 data 6320 imp { 6321 key "misc_feature" } , 6322 location 6323 int { 6324 from 0 , 6325 to 2 , 6326 strand plus , 6327 id 6328 local 6329 str "gene_xrefs" } , 6330 qual { 6331 { 6332 qual "allele" , 6333 val "not a match" } } , 6334 xref { 6335 { 6336 data 6337 gene { 6338 locus "match_on_locus" , 6339 allele "bad match" } } } } , 6340 { 6341 data 6342 gene { 6343 locus "map by overlap" , 6344 allele "no match for allele" } , 6345 location 6346 int { 6347 from 3 , 6348 to 5 , 6349 strand plus , 6350 id 6351 local 6352 str "gene_xrefs" } } , 6353 { 6354 data 6355 imp { 6356 key "misc_feature" } , 6357 location 6358 int { 6359 from 3 , 6360 to 5 , 6361 strand plus , 6362 id 6363 local 6364 str "gene_xrefs" } , 6365 qual { 6366 { 6367 qual "allele" , 6368 val "bad match" } } } , 6369 { 6370 data 6371 gene { 6372 locus "match_on_locus" } , 6373 location 6374 int { 6375 from 6 , 6376 to 8 , 6377 strand plus , 6378 id 6379 local 6380 str "gene_xrefs" } } , 6381 { 6382 data 6383 imp { 6384 key "misc_feature" } , 6385 location 6386 int { 6387 from 6 , 6388 to 8 , 6389 strand plus , 6390 id 6391 local 6392 str "gene_xrefs" } , 6393 qual { 6394 { 6395 qual "allele" , 6396 val "redundant allele" } } , 6397 xref { 6398 { 6399 data 6400 gene { 6401 locus "match_on_locus" , 6402 allele "redundant allele" } } } } , 6403 { 6404 data 6405 gene { 6406 locus "map by overlap" , 6407 allele "redundant allele" } , 6408 location 6409 int { 6410 from 9 , 6411 to 11 , 6412 strand plus , 6413 id 6414 local 6415 str "gene_xrefs" } } , 6416 { 6417 data 6418 imp { 6419 key "misc_feature" } , 6420 location 6421 int { 6422 from 9 , 6423 to 11 , 6424 strand plus , 6425 id 6426 local 6427 str "gene_xrefs" } , 6428 qual { 6429 { 6430 qual "allele" , 6431 val "redundant allele" } } } , 6432 { 6433 data 6434 gene { 6435 locus "has locus" , 6436 locus-tag "has locus tag" } , 6437 location 6438 int { 6439 from 12 , 6440 to 14 , 6441 strand plus , 6442 id 6443 local 6444 str "gene_xrefs" } } , 6445 { 6446 data 6447 imp { 6448 key "misc_feature" } , 6449 location 6450 int { 6451 from 12 , 6452 to 14 , 6453 strand plus , 6454 id 6455 local 6456 str "gene_xrefs" } , 6457 xref { 6458 { 6459 data 6460 gene { 6461 locus-tag "has locus tag" } } } } } } } } , 6462 seq { 6463 id { 6464 other { 6465 accession "NC_111111" } } , 6466 descr { 6467 source { 6468 org { 6469 taxname "Drosophila melanogaster" } } } , 6470 inst { 6471 repr raw , 6472 mol dna , 6473 length 24 , 6474 seq-data 6475 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 6476 annot { 6477 { 6478 data 6479 ftable { 6480 { 6481 data 6482 gene { 6483 locus "a" } , 6484 location 6485 int { 6486 from 0 , 6487 to 2 , 6488 strand plus , 6489 id 6490 other { 6491 accession "NC_111111" } } } , 6492 { 6493 data 6494 gene { 6495 locus "b" } , 6496 location 6497 int { 6498 from 0 , 6499 to 2 , 6500 strand minus , 6501 id 6502 other { 6503 accession "NC_111111" } } } , 6504 { 6505 data 6506 imp { 6507 key "misc_feature" } , 6508 location 6509 int { 6510 from 0 , 6511 to 2 , 6512 strand plus , 6513 id 6514 other { 6515 accession "NC_111111" } } , 6516 xref { 6517 { 6518 data 6519 gene { 6520 locus "match_on_locus" } } } } } } } } , 6521 seq { 6522 id { 6523 local 6524 str "oldlocustag" } , 6525 inst { 6526 repr raw , 6527 mol dna , 6528 length 24 , 6529 seq-data 6530 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 6531 annot { 6532 { 6533 data 6534 ftable { 6535 { 6536 data 6537 gene { 6538 locus "match_on_locus" } , 6539 location 6540 int { 6541 from 0 , 6542 to 2 , 6543 strand plus , 6544 id 6545 local 6546 str "oldlocustag" } , 6547 qual { 6548 { 6549 qual "old_locus_tag" , 6550 val "value 1" } } } , 6551 { 6552 data 6553 imp { 6554 key "misc_feature" } , 6555 location 6556 int { 6557 from 0 , 6558 to 2 , 6559 strand plus , 6560 id 6561 local 6562 str "oldlocustag" } , 6563 qual { 6564 { 6565 qual "old_locus_tag" , 6566 val "value 2" } } } } } } } , 6567 seq { 6568 id { 6569 local 6570 str "go_terms" } , 6571 descr { 6572 source { 6573 org { 6574 taxname "Drosophila melanogaster" } } } , 6575 inst { 6576 repr raw , 6577 mol dna , 6578 length 24 , 6579 seq-data 6580 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 6581 annot { 6582 { 6583 data 6584 ftable { 6585 { 6586 data 6587 imp { 6588 key "tRNA" } , 6589 location 6590 int { 6591 from 0 , 6592 to 9 , 6593 strand plus , 6594 id 6595 local 6596 str "go_terms" } , 6597 ext { 6598 type 6599 str "GeneOntology" , 6600 data { 6601 { 6602 label 6603 str "Function" , 6604 data 6605 fields { 6606 { 6607 label 6608 id 0 , 6609 data 6610 fields { 6611 { 6612 label 6613 str "text string" , 6614 data 6615 str "thiamin diphosphokinase activity" } , 6616 { 6617 label 6618 str "go id" , 6619 data 6620 str "0004788" } , 6621 { 6622 label 6623 str "evidence" , 6624 data 6625 str "ISS" } } } , 6626 { 6627 label 6628 id 0 , 6629 data 6630 fields { 6631 { 6632 label 6633 str "text string" , 6634 data 6635 str "hydrolase activity" } , 6636 { 6637 label 6638 str "go id" , 6639 data 6640 str "0016787" } , 6641 { 6642 label 6643 str "evidence" , 6644 data 6645 str "IEA" } } } } } , 6646 { 6647 label 6648 str "Process" , 6649 data 6650 fields { 6651 { 6652 label 6653 id 0 , 6654 data 6655 fields { 6656 { 6657 label 6658 str "text string" , 6659 data 6660 str "thiamin diphosphokinase activity" } , 6661 { 6662 label 6663 str "go id" , 6664 data 6665 str "0004788" } , 6666 { 6667 label 6668 str "evidence" , 6669 data 6670 str "ISS" } } } , 6671 { 6672 label 6673 id 0 , 6674 data 6675 fields { 6676 { 6677 label 6678 str "text string" , 6679 data 6680 str "hydrolase activity" } , 6681 { 6682 label 6683 str "go id" , 6684 data 6685 str "0016787" } , 6686 { 6687 label 6688 str "evidence" , 6689 data 6690 str "IEA" } } } } } , 6691 { 6692 label 6693 str "Component" , 6694 data 6695 fields { 6696 { 6697 label 6698 id 0 , 6699 data 6700 fields { 6701 { 6702 label 6703 str "text string" , 6704 data 6705 str "thiamin diphosphokinase activity" } , 6706 { 6707 label 6708 str "go id" , 6709 data 6710 str "0004788" } , 6711 { 6712 label 6713 str "evidence" , 6714 data 6715 str "ISS" } } } , 6716 { 6717 label 6718 id 0 , 6719 data 6720 fields { 6721 { 6722 label 6723 str "text string" , 6724 data 6725 str "hydrolase activity" } , 6726 { 6727 label 6728 str "go id" , 6729 data 6730 str "0016787" } , 6731 { 6732 label 6733 str "evidence" , 6734 data 6735 str "IEA" } } } } } } } } , 6736 { 6737 data 6738 imp { 6739 key "misc_feature" } , 6740 location 6741 int { 6742 from 0 , 6743 to 9 , 6744 strand plus , 6745 id 6746 local 6747 str "go_terms" } , 6748 ext { 6749 type 6750 str "GeneOntology" , 6751 data { 6752 { 6753 label 6754 str "Function" , 6755 data 6756 fields { 6757 { 6758 label 6759 id 0 , 6760 data 6761 fields { 6762 { 6763 label 6764 str "text string" , 6765 data 6766 str "match_term" } , 6767 { 6768 label 6769 str "go id" , 6770 data 6771 str "0000001" } , 6772 { 6773 label 6774 str "evidence" , 6775 data 6776 str "IEA" } } } , 6777 { 6778 label 6779 id 0 , 6780 data 6781 fields { 6782 { 6783 label 6784 str "text string" , 6785 data 6786 str "match_term" } , 6787 { 6788 label 6789 str "go id" , 6790 data 6791 str "0000001" } , 6792 { 6793 label 6794 str "evidence" , 6795 data 6796 str "IEA" } } } } } , 6797 { 6798 label 6799 str "Process" , 6800 data 6801 fields { 6802 { 6803 label 6804 id 0 , 6805 data 6806 fields { 6807 { 6808 label 6809 str "text string" , 6810 data 6811 str "thiamin diphosphokinase activity" } , 6812 { 6813 label 6814 str "go id" , 6815 data 6816 str "0000001" } , 6817 { 6818 label 6819 str "evidence" , 6820 data 6821 str "ISS" } } } , 6822 { 6823 label 6824 id 0 , 6825 data 6826 fields { 6827 { 6828 label 6829 str "text string" , 6830 data 6831 str "hydrolase activity" } , 6832 { 6833 label 6834 str "evidence" , 6835 data 6836 str "IEA" } } } } } , 6837 { 6838 label 6839 str "Component" , 6840 data 6841 fields { 6842 { 6843 label 6844 id 0 , 6845 data 6846 fields { 6847 { 6848 label 6849 str "text string" , 6850 data 6851 str "thiamin diphosphokinase activity" } , 6852 { 6853 label 6854 str "go id" , 6855 data 6856 str "0004788" } , 6857 { 6858 label 6859 str "evidence" , 6860 data 6861 str "ISS" } } } , 6862 { 6863 label 6864 id 0 , 6865 data 6866 fields { 6867 { 6868 label 6869 str "text string" , 6870 data 6871 str "hydrolase activity" } , 6872 { 6873 label 6874 str "go id" , 6875 data 6876 str "0016787" } , 6877 { 6878 label 6879 str "unrecognized field" , 6880 data 6881 str "IEA" } } } } } } } } , 6882 { 6883 data 6884 imp { 6885 key "misc_feature" } , 6886 location 6887 int { 6888 from 0 , 6889 to 9 , 6890 strand plus , 6891 id 6892 local 6893 str "go_terms" } , 6894 ext { 6895 type 6896 str "GeneOntology" , 6897 data { 6898 { 6899 label 6900 str "Unrecognized Name" , 6901 data 6902 fields { 6903 { 6904 label 6905 id 0 , 6906 data 6907 fields { 6908 { 6909 label 6910 str "text string" , 6911 data 6912 str "thiamin diphosphokinase activity" } , 6913 { 6914 label 6915 str "go id" , 6916 data 6917 str "0004788" } , 6918 { 6919 label 6920 str "evidence" , 6921 data 6922 str "ISS" } } } , 6923 { 6924 label 6925 id 0 , 6926 data 6927 fields { 6928 { 6929 label 6930 str "text string" , 6931 data 6932 str "hydrolase activity" } , 6933 { 6934 label 6935 str "go id" , 6936 data 6937 str "0016787" } , 6938 { 6939 label 6940 str "evidence" , 6941 data 6942 str "IEA" } } } } } } } } , 6943 { 6944 data 6945 imp { 6946 key "misc_feature" } , 6947 location 6948 int { 6949 from 0 , 6950 to 9 , 6951 strand plus , 6952 id 6953 local 6954 str "go_terms" } , 6955 ext { 6956 type 6957 str "GeneOntology" , 6958 data { 6959 { 6960 label 6961 str "Function" , 6962 data 6963 fields { 6964 { 6965 label 6966 id 0 , 6967 data 6968 fields { 6969 { 6970 label 6971 str "text string" , 6972 data 6973 str "thiamin diphosphokinase activity" } , 6974 { 6975 label 6976 str "go id" , 6977 data 6978 str "0004788" } , 6979 { 6980 label 6981 str "evidence" , 6982 data 6983 str "ISS" } } } , 6984 { 6985 label 6986 id 0 , 6987 data 6988 fields { 6989 { 6990 label 6991 str "text string" , 6992 data 6993 str "hydrolase activity" } , 6994 { 6995 label 6996 str "go id" , 6997 data 6998 str "0016787" } , 6999 { 7000 label 7001 str "evidence" , 7002 data 7003 str "IEA" } } } } } } } } } } } } , 7004 seq { 7005 id { 7006 local 7007 str "inference" } , 7008 inst { 7009 repr raw , 7010 mol dna , 7011 length 24 , 7012 seq-data 7013 iupacna "AATTGGCATGTTAATTGGCCAANN" } , 7014 annot { 7015 { 7016 data 7017 ftable { 7018 { 7019 data 7020 imp { 7021 key "misc_feature" } , 7022 location 7023 int { 7024 from 0 , 7025 to 1 , 7026 strand plus , 7027 id 7028 local 7029 str "inference" } , 7030 qual { 7031 { 7032 qual "inference" , 7033 val "similar to sequence" } } } , 7034 { 7035 data 7036 imp { 7037 key "misc_feature" } , 7038 location 7039 int { 7040 from 0 , 7041 to 1 , 7042 strand plus , 7043 id 7044 local 7045 str "inference" } , 7046 qual { 7047 { 7048 qual "inference" , 7049 val "similar to sequence:a" } } } , 7050 { 7051 data 7052 imp { 7053 key "misc_feature" } , 7054 location 7055 int { 7056 from 0 , 7057 to 1 , 7058 strand plus , 7059 id 7060 local 7061 str "inference" } , 7062 qual { 7063 { 7064 qual "inference" , 7065 val "similar to sequence:INSD:AY123456" } } } , 7066 { 7067 data 7068 imp { 7069 key "misc_feature" } , 7070 location 7071 int { 7072 from 0 , 7073 to 1 , 7074 strand plus , 7075 id 7076 local 7077 str "inference" } , 7078 qual { 7079 { 7080 qual "inference" , 7081 val "similar to sequence:INSD:AY123456.1" } } } , 7082 { 7083 data 7084 imp { 7085 key "misc_feature" } , 7086 location 7087 int { 7088 from 0 , 7089 to 1 , 7090 strand plus , 7091 id 7092 local 7093 str "inference" } , 7094 qual { 7095 { 7096 qual "inference" , 7097 val "similar to AA sequence" } } } , 7098 { 7099 data 7100 imp { 7101 key "misc_feature" } , 7102 location 7103 int { 7104 from 0 , 7105 to 1 , 7106 strand plus , 7107 id 7108 local 7109 str "inference" } , 7110 qual { 7111 { 7112 qual "inference" , 7113 val "similar to AA sequence:INSD:AY_123456.1" } } } , 7114 { 7115 data 7116 imp { 7117 key "misc_feature" } , 7118 location 7119 int { 7120 from 0 , 7121 to 1 , 7122 strand plus , 7123 id 7124 local 7125 str "inference" } , 7126 qual { 7127 { 7128 qual "inference" , 7129 val "similar to AA sequence:RefSeq:AY_123456.1" } } } , 7130 { 7131 data 7132 imp { 7133 key "misc_feature" } , 7134 location 7135 int { 7136 from 0 , 7137 to 1 , 7138 strand plus , 7139 id 7140 local 7141 str "inference" } , 7142 qual { 7143 { 7144 qual "inference" , 7145 val "similar to DNA sequence" } } } , 7146 { 7147 data 7148 imp { 7149 key "misc_feature" } , 7150 location 7151 int { 7152 from 0 , 7153 to 1 , 7154 strand plus , 7155 id 7156 local 7157 str "inference" } , 7158 qual { 7159 { 7160 qual "inference" , 7161 val "similar to DNA sequence:INSD:AY999999.9" } } } , 7162 { 7163 data 7164 imp { 7165 key "misc_feature" } , 7166 location 7167 int { 7168 from 0 , 7169 to 1 , 7170 strand plus , 7171 id 7172 local 7173 str "inference" } , 7174 qual { 7175 { 7176 qual "inference" , 7177 val "similar to RNA sequence" } } } , 7178 { 7179 data 7180 imp { 7181 key "misc_feature" } , 7182 location 7183 int { 7184 from 0 , 7185 to 1 , 7186 strand plus , 7187 id 7188 local 7189 str "inference" } , 7190 qual { 7191 { 7192 qual "inference" , 7193 val "similar to RNA sequence, mRNA" } } } , 7194 { 7195 data 7196 imp { 7197 key "misc_feature" } , 7198 location 7199 int { 7200 from 0 , 7201 to 1 , 7202 strand plus , 7203 id 7204 local 7205 str "inference" } , 7206 qual { 7207 { 7208 qual "inference" , 7209 val "similar to RNA sequence, EST" } } } , 7210 { 7211 data 7212 imp { 7213 key "misc_feature" } , 7214 location 7215 int { 7216 from 0 , 7217 to 1 , 7218 strand plus , 7219 id 7220 local 7221 str "inference" } , 7222 qual { 7223 { 7224 qual "inference" , 7225 val "similar to RNA sequence, other RNA" } } } , 7226 { 7227 data 7228 imp { 7229 key "misc_feature" } , 7230 location 7231 int { 7232 from 0 , 7233 to 1 , 7234 strand plus , 7235 id 7236 local 7237 str "inference" } , 7238 qual { 7239 { 7240 qual "inference" , 7241 val "profile" } } } , 7242 { 7243 data 7244 imp { 7245 key "misc_feature" } , 7246 location 7247 int { 7248 from 0 , 7249 to 1 , 7250 strand plus , 7251 id 7252 local 7253 str "inference" } , 7254 qual { 7255 { 7256 qual "inference" , 7257 val "nucleotide motif" } } } , 7258 { 7259 data 7260 imp { 7261 key "misc_feature" } , 7262 location 7263 int { 7264 from 0 , 7265 to 1 , 7266 strand plus , 7267 id 7268 local 7269 str "inference" } , 7270 qual { 7271 { 7272 qual "inference" , 7273 val "protein motif" } } } , 7274 { 7275 data 7276 imp { 7277 key "misc_feature" } , 7278 location 7279 int { 7280 from 0 , 7281 to 1 , 7282 strand plus , 7283 id 7284 local 7285 str "inference" } , 7286 qual { 7287 { 7288 qual "inference" , 7289 val "ab initio prediction" } } } , 7290 { 7291 data 7292 imp { 7293 key "misc_feature" } , 7294 location 7295 int { 7296 from 0 , 7297 to 1 , 7298 strand plus , 7299 id 7300 local 7301 str "inference" } , 7302 qual { 7303 { 7304 qual "inference" , 7305 val "alignment" } } } , 7306 { 7307 data 7308 imp { 7309 key "misc_feature" } , 7310 location 7311 int { 7312 from 0 , 7313 to 1 , 7314 strand plus , 7315 id 7316 local 7317 str "inference" } , 7318 qual { 7319 { 7320 qual "inference" , 7321 val "alignment:something:INSD|AY123456" } } } , 7322 { 7323 data 7324 imp { 7325 key "misc_feature" } , 7326 location 7327 int { 7328 from 0 , 7329 to 1 , 7330 strand plus , 7331 id 7332 local 7333 str "inference" } , 7334 qual { 7335 { 7336 qual "inference" , 7337 val "alignment:something:INSD|AY123456.1" } } } , 7338 { 7339 data 7340 imp { 7341 key "misc_feature" } , 7342 location 7343 int { 7344 from 0 , 7345 to 9 , 7346 strand plus , 7347 id 7348 local 7349 str "inference" } , 7350 qual { 7351 { 7352 qual "inference" , 7353 val "not a valid inference" } } } } } } } , 7354 seq { 7355 id { 7356 local 7357 str "rrna_its" } , 7358 descr { 7359 molinfo { 7360 biomol genomic } } , 7361 inst { 7362 repr delta , 7363 mol dna , 7364 length 630 , 7365 ext 7366 delta { 7367 literal { 7368 length 100 , 7369 seq-data 7370 iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAATTG 7371GCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA" } , 7372 literal { 7373 length 100 , 7374 fuzz 7375 lim unk } , 7376 literal { 7377 length 10 , 7378 seq-data 7379 iupacna "AATTGGCCAA" } , 7380 literal { 7381 length 100 , 7382 fuzz 7383 lim unk } , 7384 literal { 7385 length 10 , 7386 seq-data 7387 iupacna "AATTGGCCAA" } , 7388 literal { 7389 length 100 , 7390 fuzz 7391 lim unk } , 7392 literal { 7393 length 10 , 7394 seq-data 7395 iupacna "AATTGGCCAA" } , 7396 literal { 7397 length 100 , 7398 fuzz 7399 lim unk } , 7400 literal { 7401 length 100 , 7402 seq-data 7403 iupacna "AATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAAAAT 7404TGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAA" } } } , 7405 annot { 7406 { 7407 data 7408 ftable { 7409 { 7410 data 7411 rna { 7412 type rRNA , 7413 ext 7414 name "18S small" } , 7415 location 7416 int { 7417 from 0 , 7418 to 1 , 7419 strand plus , 7420 id 7421 local 7422 str "rrna_its" } } , 7423 { 7424 data 7425 rna { 7426 type other , 7427 ext 7428 name "misc_RNA" } , 7429 location 7430 int { 7431 from 3 , 7432 to 4 , 7433 strand plus , 7434 id 7435 local 7436 str "rrna_its" } , 7437 qual { 7438 { 7439 qual "product" , 7440 val "internal transcribed spacer 1" } } } , 7441 { 7442 data 7443 rna { 7444 type rRNA , 7445 ext 7446 name "5.8S ribosomal rRNA" } , 7447 location 7448 int { 7449 from 6 , 7450 to 7 , 7451 strand plus , 7452 id 7453 local 7454 str "rrna_its" } } , 7455 { 7456 data 7457 rna { 7458 type other , 7459 ext 7460 name "misc_RNA" } , 7461 location 7462 int { 7463 from 9 , 7464 to 10 , 7465 strand plus , 7466 id 7467 local 7468 str "rrna_its" } , 7469 qual { 7470 { 7471 qual "product" , 7472 val "internal transcribed spacer 2" } } } , 7473 { 7474 data 7475 rna { 7476 type rRNA , 7477 ext 7478 name "28S ribosomal rRNA" } , 7479 location 7480 int { 7481 from 12 , 7482 to 13 , 7483 strand plus , 7484 id 7485 local 7486 str "rrna_its" } } , 7487 { 7488 data 7489 rna { 7490 type rRNA , 7491 ext 7492 name "18S small" } , 7493 location 7494 int { 7495 from 52 , 7496 to 53 , 7497 strand minus , 7498 id 7499 local 7500 str "rrna_its" } } , 7501 { 7502 data 7503 rna { 7504 type other , 7505 ext 7506 name "misc_RNA" } , 7507 location 7508 int { 7509 from 49 , 7510 to 50 , 7511 strand minus , 7512 id 7513 local 7514 str "rrna_its" } , 7515 qual { 7516 { 7517 qual "product" , 7518 val "internal transcribed spacer 1" } } } , 7519 { 7520 data 7521 rna { 7522 type rRNA , 7523 ext 7524 name "5.8S ribosomal rRNA" } , 7525 location 7526 int { 7527 from 46 , 7528 to 47 , 7529 strand minus , 7530 id 7531 local 7532 str "rrna_its" } } , 7533 { 7534 data 7535 rna { 7536 type other , 7537 ext 7538 name "misc_RNA" } , 7539 location 7540 int { 7541 from 43 , 7542 to 44 , 7543 strand minus , 7544 id 7545 local 7546 str "rrna_its" } , 7547 qual { 7548 { 7549 qual "product" , 7550 val "internal transcribed spacer 2" } } } , 7551 { 7552 data 7553 rna { 7554 type rRNA , 7555 ext 7556 name "28S ribosomal rRNA" } , 7557 location 7558 int { 7559 from 40 , 7560 to 41 , 7561 strand minus , 7562 id 7563 local 7564 str "rrna_its" } } , 7565 { 7566 data 7567 rna { 7568 type rRNA , 7569 ext 7570 name "18S small" } , 7571 location 7572 int { 7573 from 20 , 7574 to 22 , 7575 strand plus , 7576 id 7577 local 7578 str "rrna_its" } } , 7579 { 7580 data 7581 rna { 7582 type other , 7583 ext 7584 name "misc_RNA" } , 7585 location 7586 int { 7587 from 22 , 7588 to 25 , 7589 strand plus , 7590 id 7591 local 7592 str "rrna_its" } , 7593 qual { 7594 { 7595 qual "product" , 7596 val "internal transcribed spacer 1" } } } , 7597 { 7598 data 7599 rna { 7600 type rRNA , 7601 ext 7602 name "5.8S ribosomal rRNA" } , 7603 location 7604 int { 7605 from 25 , 7606 to 28 , 7607 strand plus , 7608 id 7609 local 7610 str "rrna_its" } } , 7611 { 7612 data 7613 rna { 7614 type other , 7615 ext 7616 name "misc_RNA" } , 7617 location 7618 int { 7619 from 28 , 7620 to 31 , 7621 strand plus , 7622 id 7623 local 7624 str "rrna_its" } , 7625 qual { 7626 { 7627 qual "product" , 7628 val "internal transcribed spacer 2" } } } , 7629 { 7630 data 7631 rna { 7632 type rRNA , 7633 ext 7634 name "28S ribosomal rRNA" } , 7635 location 7636 int { 7637 from 31 , 7638 to 34 , 7639 strand plus , 7640 id 7641 local 7642 str "rrna_its" } } , 7643 { 7644 data 7645 rna { 7646 type rRNA , 7647 ext 7648 name "18S small" } , 7649 location 7650 int { 7651 from 91 , 7652 to 94 , 7653 strand minus , 7654 id 7655 local 7656 str "rrna_its" } } , 7657 { 7658 data 7659 rna { 7660 type other , 7661 ext 7662 name "misc_RNA" } , 7663 location 7664 int { 7665 from 88 , 7666 to 91 , 7667 strand minus , 7668 id 7669 local 7670 str "rrna_its" } , 7671 qual { 7672 { 7673 qual "product" , 7674 val "internal transcribed spacer 1" } } } , 7675 { 7676 data 7677 rna { 7678 type rRNA , 7679 ext 7680 name "5.8S ribosomal rRNA" } , 7681 location 7682 int { 7683 from 85 , 7684 to 88 , 7685 strand minus , 7686 id 7687 local 7688 str "rrna_its" } } , 7689 { 7690 data 7691 rna { 7692 type other , 7693 ext 7694 name "misc_RNA" } , 7695 location 7696 int { 7697 from 82 , 7698 to 85 , 7699 strand minus , 7700 id 7701 local 7702 str "rrna_its" } , 7703 qual { 7704 { 7705 qual "product" , 7706 val "internal transcribed spacer 2" } } } , 7707 { 7708 data 7709 rna { 7710 type rRNA , 7711 ext 7712 name "28S ribosomal rRNA" } , 7713 location 7714 int { 7715 from 80 , 7716 to 82 , 7717 strand minus , 7718 id 7719 local 7720 str "rrna_its" } } , 7721 { 7722 data 7723 rna { 7724 type rRNA , 7725 ext 7726 name "18S small" } , 7727 location 7728 int { 7729 from 97 , 7730 to 99 , 7731 strand plus , 7732 id 7733 local 7734 str "rrna_its" } } , 7735 { 7736 data 7737 rna { 7738 type other , 7739 ext 7740 name "misc_RNA" } , 7741 location 7742 int { 7743 from 200 , 7744 to 202 , 7745 strand plus , 7746 id 7747 local 7748 str "rrna_its" } , 7749 qual { 7750 { 7751 qual "product" , 7752 val "internal transcribed spacer 1" } } } , 7753 { 7754 data 7755 rna { 7756 type rRNA , 7757 ext 7758 name "5.8S ribosomal rRNA" } , 7759 location 7760 int { 7761 from 204 , 7762 to 209 , 7763 strand plus , 7764 id 7765 local 7766 str "rrna_its" } } , 7767 { 7768 data 7769 rna { 7770 type other , 7771 ext 7772 name "misc_RNA" } , 7773 location 7774 int { 7775 from 310 , 7776 to 313 , 7777 strand plus , 7778 id 7779 local 7780 str "rrna_its" } , 7781 qual { 7782 { 7783 qual "product" , 7784 val "internal transcribed spacer 2" } } } , 7785 { 7786 data 7787 rna { 7788 type other , 7789 ext 7790 name "misc_RNA" } , 7791 location 7792 int { 7793 from 315 , 7794 to 319 , 7795 strand minus , 7796 id 7797 local 7798 str "rrna_its" } , 7799 qual { 7800 { 7801 qual "product" , 7802 val "internal transcribed spacer 2" } } } , 7803 { 7804 data 7805 rna { 7806 type rRNA , 7807 ext 7808 name "5.8S ribosomal rRNA" } , 7809 location 7810 int { 7811 from 420 , 7812 to 423 , 7813 strand minus , 7814 id 7815 local 7816 str "rrna_its" } } , 7817 { 7818 data 7819 rna { 7820 type other , 7821 ext 7822 name "misc_RNA" } , 7823 location 7824 int { 7825 from 425 , 7826 to 429 , 7827 strand minus , 7828 id 7829 local 7830 str "rrna_its" } , 7831 qual { 7832 { 7833 qual "product" , 7834 val "internal transcribed spacer 1" } } } , 7835 { 7836 data 7837 rna { 7838 type rRNA , 7839 ext 7840 name "18S small" } , 7841 location 7842 int { 7843 from 530 , 7844 to 532 , 7845 strand minus , 7846 id 7847 local 7848 str "rrna_its" } } } } } } , 7849 seq { 7850 id { 7851 local 7852 str "FeatureSeqIDCaseDifference" } , 7853 descr { 7854 molinfo { 7855 biomol genomic } } , 7856 inst { 7857 repr raw , 7858 mol dna , 7859 length 100 , 7860 seq-data 7861 iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAATTGGCATGT 7862TAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA" } , 7863 annot { 7864 { 7865 data 7866 ftable { 7867 { 7868 data 7869 rna { 7870 type rRNA , 7871 ext 7872 name "18S small" } , 7873 location 7874 int { 7875 from 0 , 7876 to 1 , 7877 strand plus , 7878 id 7879 local 7880 str "featureseqidcasedifference" } } } } } } , 7881 seq { 7882 id { 7883 gi 0 } , 7884 descr { 7885 molinfo { 7886 biomol genomic } } , 7887 inst { 7888 repr raw , 7889 mol dna , 7890 length 100 , 7891 seq-data 7892 iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAATTGGCATGT 7893TAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA" } , 7894 annot { 7895 { 7896 data 7897 ftable { 7898 { 7899 data 7900 rna { 7901 type rRNA , 7902 ext 7903 name "18S small" } , 7904 location 7905 int { 7906 from 0 , 7907 to 1 , 7908 strand plus , 7909 id 7910 gi 0 } } } } } } , 7911 seq { 7912 id { 7913 local 7914 str "GapFeatureProblem" } , 7915 descr { 7916 molinfo { 7917 biomol genomic } } , 7918 inst { 7919 repr delta , 7920 mol dna , 7921 length 120 , 7922 ext 7923 delta { 7924 literal { 7925 length 10 , 7926 seq-data 7927 iupacna "CCAANNAAAA" } , 7928 literal { 7929 length 100 , 7930 fuzz 7931 lim unk } , 7932 literal { 7933 length 10 , 7934 seq-data 7935 iupacna "NNTTGGCCAA" } } } , 7936 annot { 7937 { 7938 data 7939 ftable { 7940 { 7941 data 7942 imp { 7943 key "gap" } , 7944 location 7945 int { 7946 from 10 , 7947 to 90 , 7948 id 7949 local 7950 str "GapFeatureProblem" } , 7951 qual { 7952 { 7953 qual "estimated_length" , 7954 val "100" } } } , 7955 { 7956 data 7957 imp { 7958 key "gap" } , 7959 location 7960 int { 7961 from 20 , 7962 to 119 , 7963 id 7964 local 7965 str "GapFeatureProblem" } , 7966 qual { 7967 { 7968 qual "estimated_length" , 7969 val "100" } } } , 7970 { 7971 data 7972 imp { 7973 key "gap" } , 7974 location 7975 int { 7976 from 10 , 7977 to 112 , 7978 id 7979 local 7980 str "GapFeatureProblem" } } , 7981 { 7982 data 7983 imp { 7984 key "gap" } , 7985 location 7986 int { 7987 from 10 , 7988 to 114 , 7989 id 7990 local 7991 str "GapFeatureProblem" } } , 7992 { 7993 data 7994 imp { 7995 key "gap" } , 7996 location 7997 int { 7998 from 110 , 7999 to 111 , 8000 id 8001 local 8002 str "GapFeatureProblem" } } , 8003 { 8004 data 8005 imp { 8006 key "gap" } , 8007 location 8008 int { 8009 from 112 , 8010 to 114 , 8011 id 8012 local 8013 str "GapFeatureProblem" } } } } } } , 8014 seq { 8015 id { 8016 local 8017 str "PseudoCdsHasProtXref" } , 8018 descr { 8019 molinfo { 8020 biomol genomic } } , 8021 inst { 8022 repr raw , 8023 mol dna , 8024 length 10 , 8025 seq-data 8026 iupacna "CCAANNAAAA" } , 8027 annot { 8028 { 8029 data 8030 ftable { 8031 { 8032 data 8033 cdregion { 8034 } , 8035 location 8036 int { 8037 from 0 , 8038 to 9 , 8039 id 8040 local 8041 str "PseudoCdsHasProtXref" } , 8042 xref { 8043 { 8044 data 8045 prot { 8046 name { 8047 "prot xref on pseudo cds" } } } } , 8048 pseudo TRUE } } } } } , 8049 set { 8050 class gen-prod-set , 8051 seq-set { 8052 seq { 8053 id { 8054 local 8055 str "ErroneousException_nuc" } , 8056 inst { 8057 repr raw , 8058 mol dna , 8059 length 294 , 8060 seq-data 8061 iupacna "ATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCA 8062TGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAA 8063TAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGA 8064CGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTA 8065TGTAA" } , 8066 annot { 8067 { 8068 data 8069 ftable { 8070 { 8071 data 8072 cdregion { 8073 } , 8074 except TRUE , 8075 product 8076 whole 8077 local 8078 str "ErroneousException_prot" , 8079 location 8080 int { 8081 from 0 , 8082 to 293 , 8083 id 8084 local 8085 str "ErroneousException_nuc" } , 8086 except-text "unclassified translation discrepancy" } , 8087 { 8088 data 8089 rna { 8090 type mRNA , 8091 ext 8092 name "mRNA with ErroneousException" } , 8093 except TRUE , 8094 product 8095 whole 8096 local 8097 str "ErroneousException_mrna" , 8098 location 8099 int { 8100 from 0 , 8101 to 293 , 8102 id 8103 local 8104 str "ErroneousException_nuc" } , 8105 except-text "unclassified transcription discrepancy" } } } } } , 8106 seq { 8107 id { 8108 local 8109 str "ErroneousException_prot" } , 8110 inst { 8111 repr raw , 8112 mol aa , 8113 length 97 , 8114 seq-data 8115 iupacaa "MTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIM 8116TIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIS" } } , 8117 seq { 8118 id { 8119 local 8120 str "ErroneousException_mrna" } , 8121 descr { 8122 molinfo { 8123 biomol mRNA } } , 8124 inst { 8125 repr raw , 8126 mol rna , 8127 length 294 , 8128 seq-data 8129 iupacna "ATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCA 8130TGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAA 8131TAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGA 8132CGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTA 8133GCTAA" } } } } , 8134 seq { 8135 id { 8136 local 8137 str "WholeLocation" } , 8138 inst { 8139 repr raw , 8140 mol na , 8141 length 10 , 8142 seq-data 8143 iupacna "ATGTTTAAAC" } , 8144 annot { 8145 { 8146 data 8147 ftable { 8148 { 8149 data 8150 imp { 8151 key "misc_feature" } , 8152 location 8153 whole 8154 local 8155 str "WholeLocation" , 8156 qual { 8157 { 8158 qual "standard_name" , 8159 val "Vector Contamination" } } } } } } } , 8160 set { 8161 class nuc-prot , 8162 seq-set { 8163 seq { 8164 id { 8165 local 8166 str "BadProteinName" } , 8167 inst { 8168 repr raw , 8169 mol na , 8170 length 10 , 8171 seq-data 8172 iupacna "ATGTTTAAAC" } , 8173 annot { 8174 { 8175 data 8176 ftable { 8177 { 8178 data 8179 cdregion { 8180 } , 8181 location 8182 int { 8183 from 0 , 8184 to 9, 8185 id local 8186 str "BadProteinName" } } } } } } , 8187 seq { 8188 id { 8189 local 8190 str "BadProteinName_prot1" } , 8191 inst { 8192 repr raw , 8193 mol aa , 8194 length 3 , 8195 seq-data 8196 iupacaa "MTIM" } , 8197 annot { 8198 { 8199 data 8200 ftable { 8201 { 8202 data 8203 prot { 8204 name { 8205 "Hypothetical protein" } , 8206 ec { 8207 "1.2.3.4" } } , 8208 location 8209 whole 8210 local 8211 str "BadProteinName_prot1" } , 8212 { 8213 data 8214 prot { 8215 name { 8216 "hypothetical protein" } , 8217 ec { 8218 "1.2.3.4" } } , 8219 location 8220 whole 8221 local 8222 str "BadProteinName_prot1" } , 8223 { 8224 data 8225 prot { 8226 name { 8227 "Unknown protein" } , 8228 ec { 8229 "1.2.3.4" } } , 8230 location 8231 whole 8232 local 8233 str "BadProteinName_prot1" } , 8234 { 8235 data 8236 prot { 8237 name { 8238 "unknown protein" } , 8239 ec { 8240 "1.2.3.4" } } , 8241 location 8242 whole 8243 local 8244 str "BadProteinName_prot1" } } } } } } } , 8245 set { 8246 class pop-set , 8247 seq-set { 8248 seq { 8249 id { 8250 local 8251 str "SuspiciousFrame1_lcl" } , 8252 inst { 8253 repr delta , 8254 mol dna , 8255 length 23 , 8256 ext 8257 delta { 8258 literal { 8259 length 6 , 8260 seq-data 8261 iupacna "AGAACT" } , 8262 literal { 8263 length 3 } , 8264 literal { 8265 length 14 , 8266 seq-data 8267 iupacna "AGTTGGGCCCCCCT" } } } , 8268 annot { 8269 { 8270 data 8271 ftable { 8272 { 8273 data 8274 cdregion { 8275 frame two } , 8276 comment "starts at end, should be ok" , 8277 location 8278 int { 8279 from 0 , 8280 to 5 , 8281 strand plus , 8282 id 8283 local 8284 str "SuspiciousFrame1_lcl" , 8285 fuzz-from 8286 lim lt } } , 8287 { 8288 data 8289 cdregion { 8290 frame two } , 8291 comment "Should fail, too close to end to be splice site" , 8292 location 8293 int { 8294 from 1 , 8295 to 5 , 8296 strand plus , 8297 id 8298 local 8299 str "SuspiciousFrame1_lcl" , 8300 fuzz-from 8301 lim lt } } , 8302 { 8303 data 8304 cdregion { 8305 frame two } , 8306 comment "at splice site, should be ok" , 8307 location 8308 int { 8309 from 2 , 8310 to 5 , 8311 strand plus , 8312 id 8313 local 8314 str "SuspiciousFrame1_lcl" , 8315 fuzz-from 8316 lim lt } } , 8317 { 8318 data 8319 cdregion { 8320 frame two } , 8321 comment "should fail, not at splice site" , 8322 location 8323 int { 8324 from 3 , 8325 to 5 , 8326 strand plus , 8327 id 8328 local 8329 str "SuspiciousFrame1_lcl" , 8330 fuzz-from 8331 lim lt } } , 8332 { 8333 data 8334 cdregion { 8335 frame two } , 8336 comment "starts after gap, should be ok" , 8337 location 8338 int { 8339 from 9 , 8340 to 15 , 8341 strand plus , 8342 id 8343 local 8344 str "SuspiciousFrame1_lcl" , 8345 fuzz-from 8346 lim lt } } , 8347 { 8348 data 8349 cdregion { 8350 frame two } , 8351 comment "should fail, not at splice site" , 8352 location 8353 int { 8354 from 10 , 8355 to 15 , 8356 strand plus , 8357 id 8358 local 8359 str "SuspiciousFrame1_lcl" , 8360 fuzz-from 8361 lim lt } } , 8362 { 8363 data 8364 cdregion { 8365 frame two } , 8366 comment "at splice site, should be ok" , 8367 location 8368 int { 8369 from 11 , 8370 to 15 , 8371 strand plus , 8372 id 8373 local 8374 str "SuspiciousFrame1_lcl" , 8375 fuzz-from 8376 lim lt } } , 8377 { 8378 data 8379 cdregion { 8380 frame two } , 8381 comment "should fail, not at splice site" , 8382 location 8383 int { 8384 from 12 , 8385 to 15 , 8386 strand plus , 8387 id 8388 local 8389 str "SuspiciousFrame1_lcl" , 8390 fuzz-from 8391 lim lt } } , 8392 { 8393 data 8394 cdregion { 8395 frame two } , 8396 comment "starts at end, should be ok" , 8397 location 8398 int { 8399 from 15 , 8400 to 22 , 8401 strand minus , 8402 id 8403 local 8404 str "SuspiciousFrame1_lcl" , 8405 fuzz-to 8406 lim gt } } , 8407 { 8408 data 8409 cdregion { 8410 frame two } , 8411 comment "should fail, too close to end for splice site" , 8412 location 8413 int { 8414 from 15 , 8415 to 21 , 8416 strand minus , 8417 id 8418 local 8419 str "SuspiciousFrame1_lcl" , 8420 fuzz-to 8421 lim gt } } , 8422 { 8423 data 8424 cdregion { 8425 frame two } , 8426 comment "should be ok, starts at splice site" , 8427 location 8428 int { 8429 from 15 , 8430 to 20 , 8431 strand minus , 8432 id 8433 local 8434 str "SuspiciousFrame1_lcl" , 8435 fuzz-to 8436 lim gt } } , 8437 { 8438 data 8439 cdregion { 8440 frame two } , 8441 comment "should fail, not at splice site" , 8442 location 8443 int { 8444 from 15 , 8445 to 19 , 8446 strand minus , 8447 id 8448 local 8449 str "SuspiciousFrame1_lcl" , 8450 fuzz-to 8451 lim gt } } , 8452 { 8453 data 8454 cdregion { 8455 frame two } , 8456 comment "starts after gap, should be ok" , 8457 location 8458 int { 8459 from 0 , 8460 to 5 , 8461 strand minus , 8462 id 8463 local 8464 str "SuspiciousFrame1_lcl" , 8465 fuzz-to 8466 lim gt } } , 8467 { 8468 data 8469 cdregion { 8470 frame two } , 8471 comment "too close to end for splice site, should fail" , 8472 location 8473 int { 8474 from 0 , 8475 to 4 , 8476 strand minus , 8477 id 8478 local 8479 str "SuspiciousFrame1_lcl" , 8480 fuzz-to 8481 lim gt } } , 8482 { 8483 data 8484 cdregion { 8485 frame two } , 8486 comment "should be ok, at splice site" , 8487 location 8488 int { 8489 from 0 , 8490 to 3 , 8491 strand minus , 8492 id 8493 local 8494 str "SuspiciousFrame1_lcl" , 8495 fuzz-to 8496 lim gt } } , 8497 { 8498 data 8499 cdregion { 8500 frame two } , 8501 comment "should fail, not at splice site" , 8502 location 8503 int { 8504 from 0 , 8505 to 2 , 8506 strand minus , 8507 id 8508 local 8509 str "SuspiciousFrame1_lcl" , 8510 fuzz-to 8511 lim gt } } , 8512 { 8513 data 8514 cdregion { 8515 frame two } , 8516 comment "should fail, not partial" , 8517 location 8518 int { 8519 from 2 , 8520 to 3 , 8521 strand minus , 8522 id 8523 local 8524 str "SuspiciousFrame1_lcl" } } , 8525 { 8526 data 8527 cdregion { 8528 frame two } , 8529 comment "should fail, not partial" , 8530 location 8531 int { 8532 from 2 , 8533 to 3 , 8534 strand plus , 8535 id 8536 local 8537 str "SuspiciousFrame1_lcl" } } } } } } , 8538 seq { 8539 id { 8540 other { 8541 accession "NM_SuspiciousFrame1_lcl" } } , 8542 inst { 8543 repr delta , 8544 mol dna , 8545 length 23 , 8546 ext 8547 delta { 8548 literal { 8549 length 6 , 8550 seq-data 8551 iupacna "AGAACT" } , 8552 literal { 8553 length 3 } , 8554 literal { 8555 length 14 , 8556 seq-data 8557 iupacna "AGTTGGGCCCCCCT" } } } , 8558 annot { 8559 { 8560 data 8561 ftable { 8562 { 8563 data 8564 cdregion { 8565 frame two } , 8566 comment "starts at end, should be ok" , 8567 location 8568 int { 8569 from 0 , 8570 to 5 , 8571 strand plus , 8572 id 8573 other { 8574 accession "NM_SuspiciousFrame1_lcl" } , 8575 fuzz-from 8576 lim lt } } , 8577 { 8578 data 8579 cdregion { 8580 frame two } , 8581 comment "Should fail, too close to end to be splice site" , 8582 location 8583 int { 8584 from 1 , 8585 to 5 , 8586 strand plus , 8587 id 8588 other { 8589 accession "NM_SuspiciousFrame1_lcl" } , 8590 fuzz-from 8591 lim lt } } , 8592 { 8593 data 8594 cdregion { 8595 frame two } , 8596 comment "at splice site, should be ok" , 8597 location 8598 int { 8599 from 2 , 8600 to 5 , 8601 strand plus , 8602 id 8603 other { 8604 accession "NM_SuspiciousFrame1_lcl" } , 8605 fuzz-from 8606 lim lt } } , 8607 { 8608 data 8609 cdregion { 8610 frame two } , 8611 comment "should fail, not at splice site" , 8612 location 8613 int { 8614 from 3 , 8615 to 5 , 8616 strand plus , 8617 id 8618 other { 8619 accession "NM_SuspiciousFrame1_lcl" } , 8620 fuzz-from 8621 lim lt } } , 8622 { 8623 data 8624 cdregion { 8625 frame two } , 8626 comment "starts after gap, should be ok" , 8627 location 8628 int { 8629 from 9 , 8630 to 15 , 8631 strand plus , 8632 id 8633 other { 8634 accession "NM_SuspiciousFrame1_lcl" } , 8635 fuzz-from 8636 lim lt } } , 8637 { 8638 data 8639 cdregion { 8640 frame two } , 8641 comment "should fail, not at splice site" , 8642 location 8643 int { 8644 from 10 , 8645 to 15 , 8646 strand plus , 8647 id 8648 other { 8649 accession "NM_SuspiciousFrame1_lcl" } , 8650 fuzz-from 8651 lim lt } } , 8652 { 8653 data 8654 cdregion { 8655 frame two } , 8656 comment "at splice site, should be ok" , 8657 location 8658 int { 8659 from 11 , 8660 to 15 , 8661 strand plus , 8662 id 8663 other { 8664 accession "NM_SuspiciousFrame1_lcl" } , 8665 fuzz-from 8666 lim lt } } , 8667 { 8668 data 8669 cdregion { 8670 frame two } , 8671 comment "should fail, not at splice site" , 8672 location 8673 int { 8674 from 12 , 8675 to 15 , 8676 strand plus , 8677 id 8678 other { 8679 accession "NM_SuspiciousFrame1_lcl" } , 8680 fuzz-from 8681 lim lt } } , 8682 { 8683 data 8684 cdregion { 8685 frame two } , 8686 comment "starts at end, should be ok" , 8687 location 8688 int { 8689 from 15 , 8690 to 22 , 8691 strand minus , 8692 id 8693 other { 8694 accession "NM_SuspiciousFrame1_lcl" } , 8695 fuzz-to 8696 lim gt } } , 8697 { 8698 data 8699 cdregion { 8700 frame two } , 8701 comment "should fail, too close to end for splice site" , 8702 location 8703 int { 8704 from 15 , 8705 to 21 , 8706 strand minus , 8707 id 8708 other { 8709 accession "NM_SuspiciousFrame1_lcl" } , 8710 fuzz-to 8711 lim gt } } , 8712 { 8713 data 8714 cdregion { 8715 frame two } , 8716 comment "should be ok, starts at splice site" , 8717 location 8718 int { 8719 from 15 , 8720 to 20 , 8721 strand minus , 8722 id 8723 other { 8724 accession "NM_SuspiciousFrame1_lcl" } , 8725 fuzz-to 8726 lim gt } } , 8727 { 8728 data 8729 cdregion { 8730 frame two } , 8731 comment "should fail, not at splice site" , 8732 location 8733 int { 8734 from 15 , 8735 to 19 , 8736 strand minus , 8737 id 8738 other { 8739 accession "NM_SuspiciousFrame1_lcl" } , 8740 fuzz-to 8741 lim gt } } , 8742 { 8743 data 8744 cdregion { 8745 frame two } , 8746 comment "starts after gap, should be ok" , 8747 location 8748 int { 8749 from 0 , 8750 to 5 , 8751 strand minus , 8752 id 8753 other { 8754 accession "NM_SuspiciousFrame1_lcl" } , 8755 fuzz-to 8756 lim gt } } , 8757 { 8758 data 8759 cdregion { 8760 frame two } , 8761 comment "too close to end for splice site, should fail" , 8762 location 8763 int { 8764 from 0 , 8765 to 4 , 8766 strand minus , 8767 id 8768 other { 8769 accession "NM_SuspiciousFrame1_lcl" } , 8770 fuzz-to 8771 lim gt } } , 8772 { 8773 data 8774 cdregion { 8775 frame two } , 8776 comment "should be ok, at splice site" , 8777 location 8778 int { 8779 from 0 , 8780 to 3 , 8781 strand minus , 8782 id 8783 other { 8784 accession "NM_SuspiciousFrame1_lcl" } , 8785 fuzz-to 8786 lim gt } } , 8787 { 8788 data 8789 cdregion { 8790 frame two } , 8791 comment "should fail, not at splice site" , 8792 location 8793 int { 8794 from 0 , 8795 to 2 , 8796 strand minus , 8797 id 8798 other { 8799 accession "NM_SuspiciousFrame1_lcl" } , 8800 fuzz-to 8801 lim gt } } , 8802 { 8803 data 8804 cdregion { 8805 frame two } , 8806 comment "should fail, not partial" , 8807 location 8808 int { 8809 from 2 , 8810 to 3 , 8811 strand minus , 8812 id 8813 other { 8814 accession "NM_SuspiciousFrame1_lcl" } } } , 8815 { 8816 data 8817 cdregion { 8818 frame two } , 8819 comment "should fail, not partial" , 8820 location 8821 int { 8822 from 2 , 8823 to 3 , 8824 strand plus , 8825 id 8826 other { 8827 accession "NM_SuspiciousFrame1_lcl" } } } } } } } } } } } 8828