test_cases/FixFeatureIds/comparison_1.raw_test.ref

Seq-entry ::= set {
  class genbank,
  seq-set {
    seq {
      id {
        local str "badinst1"
      },
      inst {
        repr virtual,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst2"
      },
      inst {
        repr ref,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst3"
      },
      inst {
        repr raw,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst4"
      },
      inst {
        repr const,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst5"
      },
      inst {
        repr delta,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst6"
      },
      inst {
        repr raw,
        mol dna,
        length 549,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst7"
      },
      inst {
        repr raw,
        mol aa,
        length 549,
        topology circular,
        strand ds,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst8"
      },
      inst {
        repr raw,
        mol not-set,
        length 549,
        topology circular,
        strand ds,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst9"
      },
      inst {
        repr raw,
        mol other,
        length 549,
        topology circular,
        strand ds,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst10"
      },
      inst {
        repr raw,
        mol na,
        length 549,
        topology circular,
        strand ds,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst11"
      },
      inst {
        repr raw,
        mol dna,
        length 549,
        fuzz lim unk,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst12"
      },
      inst {
        repr raw,
        mol dna,
        length 0,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst13"
      },
      inst {
        repr raw,
        mol aa,
        length 16,
        seq-data iupacna "AATTGGCCAATTGGCC"
      }
    },
    seq {
      id {
        local str "badinst14"
      },
      inst {
        repr raw,
        mol na,
        length 16,
        seq-data iupacaa "QBTTQRSTSSTTAAGC"
      }
    },
    seq {
      id {
        local str "badinst15"
      },
      inst {
        repr raw,
        mol na,
        length 10,
        seq-data iupacna "AATTGGCCAATTGGCC"
      }
    },
    seq {
      id {
        local str "badinst16"
      },
      inst {
        repr raw,
        mol na,
        length 10,
        seq-data iupacna "AATTQGCCAATTGGCC"
      }
    },
    seq {
      id {
        local str "badinst17_reprseg"
      },
      inst {
        repr seg,
        mol aa,
        length 30,
        ext seg {
          int {
            from 0,
            to 9,
            strand plus,
            id other {
              accession "YP_238673",
              version 1
            },
            fuzz-from lim lt
          },
          int {
            from 20,
            to 29,
            strand plus,
            id other {
              accession "YP_238673",
              version 1
            }
          }
        }
      }
    },
    seq {
      id {
        local str "badinst18"
      },
      descr {
        molinfo {
          tech est
        }
      },
      inst {
        repr delta,
        mol dna,
        length 120,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst19",
        local str "another local ID"
      },
      descr {
        molinfo {
          biomol rRNA,
          tech sts
        }
      },
      inst {
        repr raw,
        mol dna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        other {
          name "badinst 20"
        }
      },
      descr {
        molinfo {
          biomol genomic,
          tech sts
        }
      },
      inst {
        repr raw,
        mol rna,
        length 549,
        seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28FE33
7E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACCC3CF
E3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD7D0C
FF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
      }
    },
    seq {
      id {
        local str "badinst21"
      },
      inst {
        repr raw,
        mol aa,
        length 18,
        seq-data iupacaa "AATTGCCAATTGGCCXXX"
      }
    },
    seq {
      id {
        local str "badinst22"
      },
      descr {
        molinfo {
          tech wgs
        }
      },
      inst {
        repr delta,
        mol dna,
        length 141,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 31,
            seq-data iupacna "AATTNNNNNNNNNNNNNNNNNNNNNGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst23"
      },
      inst {
        repr delta,
        mol dna,
        length 30,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 0,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 0
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        swissprot {
          accession "badinst24",
          version 1
        }
      },
      descr {
        user {
          type str "TpaAssembly",
          data {
          }
        }
      },
      inst {
        repr delta,
        mol dna,
        length 30,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 0,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 0
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          }
        }
      }
    },
    seq {
      id {
        local str "badinst25"
      },
      descr {
        molinfo {
          tech htgs-2
        },
        user {
          type str "TpaAssembly",
          data {
          }
        }
      },
      inst {
        repr delta,
        mol dna,
        length 35,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          loc int {
            from 0,
            to 4,
            id genbank {
              accession "AY123456",
              version 1
            }
          }
        },
        hist {
          assembly {
            {
              type global,
              dim 2,
              segs denseg {
                dim 2,
                numseg 1,
                ids {
                  local str "badinst25",
                  genbank {
                    accession "AY123456",
                    version 1
                  }
                },
                starts {
                  0,
                  0
                },
                lens {
                  30
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "badinst26_prot",
        general {
          db "WGS:AABU",
          tag str "chrUn.0030"
        }
      },
      inst {
        repr raw,
        mol aa,
        length 9,
        seq-data ncbieaa "XXQRST-PP"
      }
    },
    seq {
      id {
        local str "badinst27"
      },
      inst {
        repr raw,
        mol dna,
        length 20,
        seq-data iupacna "NNNNAAAATTTTGGGGCCCC"
      }
    },
    seq {
      id {
        local str "badinst28"
      },
      inst {
        repr delta,
        mol dna,
        length 324,
        ext delta {
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 12,
            seq-data iupacna "NNAATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          }
        }
      }
    },
    seq {
      id {
        genbank {
          accession "badinst26",
          version 1
        }
      },
      descr {
        molinfo {
          biomol genomic
        },
        title "complete genome"
      },
      inst {
        repr raw,
        mol dna,
        length 16,
        topology circular,
        seq-data iupacna "AATTGGCCAATTGGCC"
      }
    },
    seq {
      id {
        local str "badinst29"
      },
      inst {
        repr delta,
        mol dna,
        length 33,
        ext delta {
          loc int {
            from 0,
            to 10,
            id genbank {
              accession "AY123456",
              version 1
            }
          },
          loc int {
            from 0,
            to 10,
            id genbank {
              accession "AY123456",
              version 1
            }
          },
          loc int {
            from 0,
            to 10,
            id genbank {
              accession "AY123457",
              version 1
            }
          }
        }
      }
    },
    seq {
      id {
        local str "badinst30"
      },
      descr {
        molinfo {
          tech tsa
        }
      },
      inst {
        repr raw,
        mol dna,
        length 110,
        seq-data iupacna "AAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT"
      }
    },
    seq {
      id {
        local str "badinst31"
      },
      descr {
        molinfo {
          tech tsa
        }
      },
      inst {
        repr delta,
        mol dna,
        length 33,
        ext delta {
          loc int {
            from 0,
            to 10,
            id gi 0
          },
          loc int {
            from 0,
            to 10,
            id local str "badinst31"
          },
          loc whole genbank {
            accession "AY123457",
            version 1
          }
        }
      }
    },
    seq {
      id {
        local str "badinst32"
      },
      inst {
        repr raw,
        mol dna,
        length 110,
        seq-data iupacna "AAAAANNNNNNNNNNNNNNNNN----NNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTT"
      }
    },
    seq {
      id {
        local str "badinst33"
      },
      descr {
        modif {
          other
        },
        source {
          org {
            taxname "first organism"
          },
          subtype {
            {
              subtype country,
              name "wonderland"
            }
          }
        },
        source {
          org {
            taxname "first organism"
          },
          subtype {
            {
              subtype country,
              name "alice"
            }
          }
        }
      },
      inst {
        repr delta,
        mol dna,
        length 112,
        ext delta {
          literal {
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          },
          literal {
            length 100,
            fuzz lim unk
          }
        }
      }
    },
    seq {
      id {
        local str "baddescr1"
      },
      descr {
        mol-type mRNA,
        mol-type tRNA,
        mol-type rRNA,
        modif {
          dna,
          rna,
          extrachrom,
          plasmid,
          mitochondrial,
          chloroplast,
          kinetoplast,
          cyanelle,
          synthetic,
          recombinant,
          partial,
          complete,
          mutagen,
          natmut,
          transposon,
          insertion-seq,
          no-left,
          no-right,
          macronuclear,
          proviral,
          est,
          sts,
          survey,
          chromoplast,
          genemap,
          restmap,
          physmap,
          other
        },
        genbank {
          origin "foo"
        },
        genbank {
          origin "bar"
        },
        embl {
          creation-date std {
            year 1980,
            month 1,
            day 1
          },
          update-date std {
            year 1980,
            month 1,
            day 1
          },
          extra-acc {
            "AY123456",
            "AY123457"
          }
        },
        embl {
          creation-date std {
            year 1980,
            month 2,
            day 8
          },
          update-date std {
            year 1980,
            month 2,
            day 8
          },
          extra-acc {
            "AY123458",
            "AY123459"
          }
        },
        pir {
          placement "foo"
        },
        pir {
          placement "bar"
        }
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        genbank {
          accession "baddescr2",
          version 1
        }
      },
      descr {
        source {
          genome transposon,
          org {
            orgname {
              mod {
                {
                  subtype other,
                  subname "variety:wikki"
                }
              }
            }
          },
          subtype {
            {
              subtype transposon-name,
              name "foo"
            },
            {
              subtype other,
              name "ecotype:bar"
            },
            {
              subtype germline,
              name "a"
            },
            {
              subtype rearranged,
              name "a"
            },
            {
              subtype transgenic,
              name "a"
            },
            {
              subtype environmental-sample,
              name "a"
            },
            {
              subtype metagenomic,
              name "a"
            },
            {
              subtype sex,
              name "P"
            },
            {
              subtype lat-lon,
              name "50 S 50 E"
            },
            {
              subtype country,
              name "Ukraine"
            },
            {
              subtype mating-type,
              name "hermaphrodite"
            }
          },
          is-focus NULL
        },
        user {
          type str "RefGeneTracking",
          data {
          }
        },
        molinfo {
          biomol genomic,
          completeness complete
        },
        pub {
          pub {
            pmid 1,
            pmid 1
          }
        },
        pub {
          pub {
            pmid 1,
            pmid 2
          }
        },
        pub {
          pub {
            muid 3,
            muid 3
          }
        },
        pub {
          pub {
            muid 3,
            muid 4
          }
        },
        title "a useless definition line [company=bad]:",
        title "a second useless definition line"
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        local str "baddescr3"
      },
      descr {
        source {
          org {
            orgname {
              lineage "Viruses; other stuff"
            }
          },
          subtype {
            {
              subtype sex,
              name "hermaphrodite"
            },
            {
              subtype mating-type,
              name "should not be here"
            },
            {
              subtype plasmid-name,
              name "should not be here"
            },
            {
              subtype plastid-name,
              name "chloroplast"
            },
            {
              subtype plastid-name,
              name "chromoplast"
            },
            {
              subtype plastid-name,
              name "kinetoplast"
            },
            {
              subtype plastid-name,
              name "plastid"
            },
            {
              subtype plastid-name,
              name "apicoplast"
            },
            {
              subtype plastid-name,
              name "leucoplast"
            },
            {
              subtype plastid-name,
              name "proplastid"
            },
            {
              subtype plastid-name,
              name "unrecognized name"
            },
            {
              subtype frequency,
              name "1"
            },
            {
              subtype frequency,
              name "kenneth"
            },
            {
              subtype cell-line,
              name "kenneth"
            },
            {
              subtype cell-type,
              name "kenneth"
            },
            {
              subtype tissue-type,
              name "kenneth"
            },
            {
              subtype lat-lon,
              name "50 S 31 E"
            },
            {
              subtype country,
              name "Ukraine"
            },
            {
              subtype fwd-primer-seq,
              name "(aaaa,aaaa)"
            },
            {
              subtype rev-primer-seq,
              name "(cccc,cccc)"
            },
            {
              subtype collection-date,
              name "not a valid date"
            }
          }
        },
        comment " "
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        local str "baddescr4"
      },
      descr {
        name "name1",
        name "name2",
        comment "comment",
        comment "comment",
        source {
          org {
            orgname {
              lineage "Viruses; other stuff"
            }
          },
          subtype {
            {
              subtype sex,
              name "hermaphrodite"
            },
            {
              subtype cell-line,
              name "a"
            },
            {
              subtype cell-type,
              name "b"
            },
            {
              subtype tissue-type,
              name "c"
            },
            {
              subtype lat-lon,
              name "not a good latlon format"
            },
            {
              subtype lat-lon,
              name "another bad latlon format"
            },
            {
              subtype lat-lon,
              name "1000 N 500 E"
            },
            {
              subtype fwd-primer-seq,
              name "qwerty"
            },
            {
              subtype fwd-primer-name,
              name "AATTGGCCAATTGGCC"
            },
            {
              subtype rev-primer-seq,
              name "qwerty"
            },
            {
              subtype rev-primer-name,
              name "AATTGGCCAATTGGCC"
            },
            {
              subtype fwd-primer-seq,
              name "aaattgggcc"
            },
            {
              subtype fwd-primer-name,
              name "ok primer name"
            },
            {
              subtype rev-primer-seq,
              name "ccaaattgggccc"
            },
            {
              subtype rev-primer-name,
              name "ok rev primer name"
            },
            {
              subtype collection-date,
              name "05-Aug-2038"
            }
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        local str "baddescr5"
      },
      descr {
        user {
          type str "RefGeneTracking",
          data {
            {
              label str "Status",
              data str "Not a legal status"
            }
          }
        },
        source {
          org {
            orgname {
              mod {
                {
                  subtype nat-host,
                  subname "Looks sciency"
                }
              }
            }
          },
          subtype {
            {
              subtype lat-lon,
              name "45 N 70 W"
            },
            {
              subtype country,
              name "USA: Florida"
            }
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        local str "baddescr6"
      },
      descr {
        pub {
          pub {
            sub {
              authors {
                names std {
                  {
                    name name {
                      last "et al."
                    }
                  },
                  {
                    name name {
                      last "et",
                      initials "al"
                    }
                  },
                  {
                    name name {
                      last "et al.",
                      first "Colleen",
                      initials "C.J."
                    }
                  }
                },
                affil std {
                  affil "  inst  ",
                  div "  dept  ",
                  city "  city  ",
                  sub "  state  ",
                  street "  address  ",
                  email "  email  ",
                  fax "  fax  ",
                  phone "  phone  ",
                  postal-code "  code  "
                }
              },
              date std {
                year 2097,
                month 255,
                day 191,
                season "'#*##"
              }
            }
          }
        },
        pub {
          pub {
            sub {
              authors {
                names std {
                  {
                    name name {
                      last "?"
                    }
                  }
                },
                affil std {
                  affil "  inst  ",
                  div "  dept  ",
                  city "  city  ",
                  country "USA",
                  street "  address  ",
                  email "  email  ",
                  fax "  fax  ",
                  phone "  phone  ",
                  postal-code "  code  "
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "0"
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "123-abc"
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "0-150"
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "60-50"
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "60--50"
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  pages "10-150"
                }
              }
            }
          }
        },
        pub {
          pub {
            medline {
              em str "?",
              cit {
                from journal {
                  title {
                    name ""
                  },
                  imp {
                    date str "?"
                  }
                }
              }
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is a cit-gen with a bad date.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              date std {
                year 2038,
                month 13
              },
              title "This is a cit-gen."
            },
            pmid 6
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name "article with bad date"
                },
                imp {
                  date std {
                    year 2038,
                    month 12,
                    day 32
                  },
                  pages "1-20"
                }
              }
            }
          }
        },
        pub {
          pub {
            gen {
              cit "Title=This is a cit-gen.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 42,
              title "This is a cit-gen."
            },
            equiv {
              gen {
                cit "Journal=This is a cit-gen without authors.  It should
 trigger a validator error.",
                authors {
                  names str {
                    "?"
                  }
                },
                serial-number 42,
                title "This is a cit-gen without authors.  It should trigger a
 validator error."
              },
              sub {
                authors {
                  names std {
                    {
                      name name {
                        last "Bollin"
                      }
                    }
                  }
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  prepub submitted,
                  pubstatus aheadofprint
                }
              }
            }
          }
        },
        pub {
          pub {
            article {
              from journal {
                title {
                  name ""
                },
                imp {
                  date str "?",
                  prepub in-press,
                  pubstatus epublish
                }
              }
            }
          }
        },
        pub {
          pub {
            sub {
              authors {
                names std {
                  {
                    name consortium "this one consortium"
                  },
                  {
                    name consortium "this one consortium"
                  },
                  {
                    name consortium " "
                  },
                  {
                    name consortium "this other consortium"
                  }
                }
              }
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is a cit-gen with serial number 43.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 43,
              title "This is a cit-gen."
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is also 43.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 43,
              title "This is a cit-gen."
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is 44.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 44,
              title "This is a cit-gen."
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is 45.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 45,
              title "This is a cit-gen."
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is also 45.",
              authors {
                names str {
                  "An unstructured name"
                }
              },
              serial-number 45,
              title "This is a cit-gen."
            }
          }
        },
        create-date std {
          year 2038,
          month 13,
          day 3
        },
        update-date std {
          year 2038,
          month 12,
          day 32
        },
        source {
          genome chromosome,
          org {
            orgname {
              mod {
                {
                  subtype acronym,
                  subname "(no right"
                },
                {
                  subtype acronym,
                  subname "no left)"
                },
                {
                  subtype bio-material,
                  subname ":coll:specid"
                },
                {
                  subtype bio-material,
                  subname ":coll:"
                },
                {
                  subtype bio-material,
                  subname "::"
                },
                {
                  subtype bio-material,
                  subname "abs:coll:specid"
                },
                {
                  subtype bio-material,
                  subname "abb:specid"
                },
                {
                  subtype bio-material,
                  subname "ABB:coll:specid"
                },
                {
                  subtype culture-collection,
                  subname "unstructured value"
                },
                {
                  subtype culture-collection,
                  subname "abc:def:ghi"
                }
              }
            }
          },
          subtype {
            {
              subtype clone,
              name "[no right"
            },
            {
              subtype clone,
              name "no left]"
            },
            {
              subtype country,
              name "australia"
            },
            {
              subtype country,
              name "Siam"
            }
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      },
      annot {
        {
          data ftable {
            {
              data pub {
                pub {
                  article {
                    from journal {
                      title {
                        name ""
                      },
                      imp {
                        date str "?"
                      }
                    }
                  }
                }
              },
              location int {
                from 0,
                to 6,
                strand plus,
                id local str "baddescr6"
              }
            }
          }
        }
      }
    },
    set {
      class pop-set,
      seq-set {
        seq {
          id {
            local str "pop1"
          },
          descr {
            comment "[123456]",
            molinfo {
              biomol genomic
            },
            source {
              genome kinetoplast,
              org {
                taxname "first organism",
                orgname {
                  mod {
                    {
                      subtype 0,
                      subname "foo"
                    },
                    {
                      subtype 1,
                      subname "bar"
                    }
                  },
                  lineage "something undetermined"
                }
              }
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data biosrc {
                    genome nucleomorph,
                    org {
                      taxname "a different taxname",
                      orgname {
                        lineage "something undetermined"
                      }
                    },
                    subtype {
                      {
                        subtype chromosome,
                        name "chromosome 1"
                      },
                      {
                        subtype 0,
                        name "something"
                      },
                      {
                        subtype chromosome,
                        name "chromosome 2"
                      }
                    },
                    is-focus NULL
                  },
                  location int {
                    from 0,
                    to 6,
                    strand plus,
                    id local str "pop1"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "pop2"
          },
          descr {
            molinfo {
              biomol rRNA
            },
            source {
              org {
                taxname "second organism"
              }
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          }
        },
        set {
          class nuc-prot,
          seq-set {
            seq {
              id {
                local str "pop3"
              },
              descr {
                molinfo {
                  biomol genomic
                }
              },
              inst {
                repr raw,
                mol dna,
                length 12,
                seq-data iupacna "AATTGGCCAANN"
              }
            },
            seq {
              id {
                local str "pop3_prot"
              },
              descr {
                molinfo {
                  biomol peptide
                }
              },
              inst {
                repr raw,
                mol aa,
                length 12,
                seq-data iupacaa "AATTGGCCAANN"
              },
              annot {
                {
                  data ftable {
                    {
                      data gene {
                        locus "gene should not be on protein"
                      },
                      location int {
                        from 0,
                        to 12,
                        strand plus,
                        id local str "pop3_prot"
                      }
                    }
                  }
                }
              }
            }
          }
        }
      }
    },
    set {
      class pop-set,
      seq-set {
        seq {
          id {
            local str "pop4"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          }
        },
        seq {
          id {
            local str "pop5"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          }
        },
        set {
          class nuc-prot,
          seq-set {
            seq {
              id {
                local str "pop6"
              },
              descr {
                molinfo {
                  biomol genomic
                }
              },
              inst {
                repr raw,
                mol dna,
                length 12,
                seq-data iupacna "AATTGGCCAANN"
              }
            },
            seq {
              id {
                local str "pop6_prot"
              },
              descr {
                molinfo {
                  biomol peptide
                }
              },
              inst {
                repr raw,
                mol aa,
                length 12,
                seq-data iupacaa "AATTGGCCAANN"
              }
            }
          }
        }
      }
    },
    set {
      class genbank,
      seq-set {
        seq {
          id {
            local str "pkg5"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          }
        },
        seq {
          id {
            local str "pkg6"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 12,
            seq-data iupacna "AATTGGCCAANN"
          }
        }
      }
    },
    seq {
      id {
        gi 123456
      },
      inst {
        repr raw,
        mol dna,
        length 16,
        seq-data iupacna "AATTGGCCAATTGGCC",
        hist {
          replaced-by {
            date std {
              year 2004,
              month 2,
              day 26
            },
            ids {
              gi 123456
            }
          }
        }
      }
    },
    seq {
      id {
        tpg {
          accession "BD000024",
          version 1
        }
      },
      inst {
        repr raw,
        mol dna,
        length 18,
        seq-data iupacna "AATTGGCCAATTGGCCNN"
      }
    },
    seq {
      id {
        genbank {
          accession "BD000022",
          version 1
        },
        genbank {
          accession "BD000023",
          version 1
        },
        gi 1
      },
      descr {
        genbank {
          extra-accessions {
            "BD000022",
            "BD000023"
          }
        },
        embl {
          creation-date std {
            year 1980,
            month 1,
            day 1
          },
          update-date std {
            year 1980,
            month 1,
            day 1
          },
          extra-acc {
            "BD000022",
            "BD000023"
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 16,
        seq-data iupacna "AATTGGCCAATTGGCC"
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np1"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np1_prot"
          },
          descr {
            title "An instantiated protein title"
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                orf TRUE,
                code {
                  id 1
                }
              },
              product whole local str "np1_prot",
              location int {
                from 0,
                to 875,
                strand plus,
                id local str "np1"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np2"
          },
          descr {
            source {
              org {
                taxname "not a mergeable taxname"
              }
            }
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np2_prot"
          },
          descr {
            title "An instantiated protein title",
            source {
              org {
                taxname "a taxname for a protein",
                db {
                  {
                    db "database1",
                    tag str "foo"
                  },
                  {
                    db "database1",
                    tag str "bar"
                  }
                }
              }
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np2_prot",
              location int {
                from 0,
                to 875,
                strand plus,
                id local str "np2"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np3"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np5"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np3_prot"
          },
          descr {
            title "An instantiated protein title"
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np4"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np4_prot"
          },
          descr {
            title "An instantiated protein title"
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      }
    },
    set {
      class gen-prod-set,
      seq-set {
        seq {
          id {
            local str "gps1"
          },
          inst {
            repr delta,
            mol dna,
            length 120,
            ext delta {
              literal {
                length 10,
                seq-data iupacna "AATTGGCCAA"
              },
              literal {
                length 100,
                fuzz lim unk
              },
              literal {
                length 10,
                seq-data iupacna "AATTGGCCAA"
              }
            }
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type mRNA,
                    ext name "misplaced"
                  },
                  product whole local str "seq_not_here",
                  location int {
                    from 0,
                    to 9,
                    strand plus,
                    id local str "gps1"
                  }
                }
              }
            }
          }
        },
        set {
          class nuc-prot,
          seq-set {
            seq {
              id {
                local str "gps2"
              },
              inst {
                repr raw,
                mol rna,
                length 10,
                seq-data iupacaa "AATTGGCCAA"
              }
            },
            seq {
              id {
                local str "gps2_prot"
              },
              inst {
                repr raw,
                mol aa,
                length 10,
                seq-data iupacaa "AATTGGCCAA"
              }
            }
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type rRNA,
                ext name "misplaced"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id genbank {
                  accession "EZ000163",
                  version 1
                }
              }
            }
          }
        }
      }
    },
    set {
      class gen-prod-set,
      seq-set {
        seq {
          id {
            local str "gps3"
          },
          inst {
            repr delta,
            mol dna,
            length 120,
            ext delta {
              literal {
                length 10,
                seq-data iupacna "AATTGGCCAA"
              },
              literal {
                length 100,
                fuzz lim unk
              },
              literal {
                length 10,
                seq-data iupacna "AATTGGCCAA"
              }
            }
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "gps_gene"
                  },
                  location int {
                    from 0,
                    to 9,
                    strand plus,
                    id local str "gps3"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "misplaced"
                  },
                  product whole local str "gps4",
                  location int {
                    from 0,
                    to 9,
                    strand plus,
                    id local str "gps3"
                  }
                }
              }
            }
          }
        },
        set {
          class nuc-prot,
          seq-set {
            seq {
              id {
                local str "gps4"
              },
              inst {
                repr raw,
                mol rna,
                length 10,
                seq-data iupacna "AAUUGGCCAA"
              },
              annot {
                {
                  data ftable {
                    {
                      data gene {
                        locus "gps_gene_not_match"
                      },
                      location int {
                        from 0,
                        to 9,
                        strand plus,
                        id local str "gps4"
                      }
                    },
                    {
                      data cdregion {
                      },
                      product whole local str "gps4_prot",
                      location int {
                        from 0,
                        to 9,
                        strand plus,
                        id local str "gps4"
                      }
                    }
                  }
                }
              }
            },
            seq {
              id {
                local str "gps4_prot"
              },
              inst {
                repr raw,
                mol aa,
                length 10,
                seq-data iupacaa "AATTGGCCAA"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat1_prot"
      },
      inst {
        repr raw,
        mol aa,
        length 10,
        seq-data iupacaa "AATTGGCCAA"
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_prot"
              }
            },
            {
              data rna {
                type rRNA,
                ext name "misplaced"
              },
              location int {
                from 0,
                to 9,
                strand minus,
                id local str "feat1_prot"
              }
            },
            {
              data rsite str "foo",
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_prot"
              }
            },
            {
              data txinit {
                name "txinit should not be on prot",
                txsystem unknown
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_prot"
              }
            },
            {
              data gene {
                locus "gene should not be on prot"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_prot"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat1_nuc"
      },
      inst {
        repr raw,
        mol dna,
        length 10,
        seq-data iupacaa "AATTGGCCAA"
      },
      annot {
        {
          data ftable {
            {
              data prot {
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data psec-str helix,
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "mat_peptide"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "sig_peptide"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "transit_peptide"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "preprotein"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "proprotein"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "mRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "tRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "rRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "snRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "scRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "snoRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "misc_RNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            },
            {
              data imp {
                key "precursor_RNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_nuc"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat1_mrna"
      },
      descr {
        molinfo {
          biomol mRNA
        }
      },
      inst {
        repr raw,
        mol rna,
        length 20,
        seq-data iupacaa "AATTGGCCAAAATTGGCCAA"
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type mRNA,
                ext name "no mRNA on mRNA seq"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_mrna"
              }
            },
            {
              data imp {
                key "CAAT_signal"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_mrna"
              },
              qual {
                {
                  qual "replace",
                  val "AATTGGCCAA"
                },
                {
                  qual "phenotype",
                  val "inappropriate qual for CAAT_signal"
                }
              }
            },
            {
              data cdregion {
              },
              location mix {
                int {
                  from 0,
                  to 3,
                  strand plus,
                  id local str "feat1_mrna"
                },
                int {
                  from 6,
                  to 9,
                  strand plus,
                  id local str "feat1_mrna"
                }
              },
              pseudo TRUE
            },
            {
              data cdregion {
              },
              location mix {
                int {
                  from 0,
                  to 3,
                  strand plus,
                  id local str "feat1_mrna"
                },
                int {
                  from 6,
                  to 9,
                  strand plus,
                  id local str "feat1_mrna"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat1_prerna"
      },
      descr {
        molinfo {
          biomol pre-RNA
        }
      },
      inst {
        repr raw,
        mol rna,
        length 10,
        seq-data iupacaa "AATTGGCCAA"
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "CAAT_signal"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "feat1_prerna"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      descr {
        source {
          genome genomic,
          org {
            taxname "  Acanthamoeba:: castellanii ,,,",
            common "  some;; common name.~~;, ",
            mod {
              " a;;b ;,;, ",
              " c::d ;,;,. "
            },
            syn {
              " a;;b ;,;, ",
              " c::d ;,;,. "
            },
            orgname {
              attrib " a;;b ;,;, ",
              mod {
                {
                  subtype acronym,
                  subname " a;;b ;,;, "
                },
                {
                  subtype authority,
                  subname " c::d ;,;,;. "
                }
              },
              lineage "  a;;b ;,;,. ",
              div " c::d ;,;,;, "
            }
          },
          subtype {
            {
              subtype country,
              name "wonderland"
            },
            {
              subtype chromosome,
              name "1:2"
            },
            {
              subtype chromosome,
              name "  a::b ,,,;;;  "
            }
          }
        },
        pub {
          pub {
            patent {
              title "This is a patent without authors.  It should not trigger
 a validator error.",
              authors {
                names str {
                  "?"
                }
              },
              country "USA",
              doc-type "document type"
            }
          }
        },
        pub {
          pub {
            gen {
              cit "This is a cit-gen without authors.  It should trigger a
 validator error.",
              authors {
                names str {
                  "?"
                }
              },
              serial-number 42,
              title "This is a cit-gen without authors.  It should trigger a
 validator error."
            }
          }
        },
        pub {
          pub {
            sub {
              authors {
                names std {
                  {
                    name name {
                      last "  Bollin  ",
                      first "  Colleen  ",
                      initials "  C.J.  "
                    }
                  }
                }
              }
            }
          }
        },
        pub {
          pub {
            gen {
              cit "Unpublished",
              authors {
                names std {
                  {
                    name name {
                      last "  Bollin  ",
                      first "  Colleen  ",
                      initials "  C.J.  "
                    }
                  }
                },
                affil std {
                  affil "<applet",
                  div "  dept  ",
                  city "  city  ",
                  sub "  state  ",
                  country "  country  ",
                  street "  address  ",
                  email "  email  ",
                  fax "  fax  ",
                  phone "  phone  ",
                  postal-code "  code  "
                }
              },
              serial-number 42,
              title "  one unpublished pub  "
            }
          },
          name "  pubdesc has a name;,;,  ",
          comment "  pubdesc;; has a comment;,;,  "
        }
      },
      seq-set {
        seq {
          id {
            genbank {
              accession "EZ000163",
              version 1
            }
          },
          descr {
            genbank {
              extra-accessions {
                " a::b;,~ ",
                " c;;d;,;,. ",
                " c;d ",
                " a;;b;,~ "
              },
              source " a::b;,~ ",
              keywords {
                " a::b;,~ ",
                " c;;d;,;, ",
                " c;d ",
                " a;;b;,~ "
              },
              origin " a;;b~;, ",
              date "  a,,b,~; ",
              div "  a~~b  ",
              taxonomy "  a  b  "
            },
            embl {
              creation-date std {
                year 1980,
                month 1,
                day 1
              },
              update-date std {
                year 1980,
                month 1,
                day 1
              },
              extra-acc {
                " a;;b;,;,. ",
                " c::d;,;, "
              }
            },
            title "  (578 - :: 1126) ,,; ",
            region "  (578 - :: 1126) ,,; ",
            molinfo {
              biomol genomic,
              tech htgs-1
            },
            create-date std {
              year 2008,
              month 12,
              day 5
            },
            name "  foo;a ,;~ "
          },
          inst {
            repr raw,
            mol dna,
            length 549,
            seq-data ncbi2na 'E0FB1F023FECCBF0FCFC3B36BC6FAE0C8A34BF0B18030C28
FE337E3FB77FA34C26EFAEFBF33CF7E8BBAAE8FCCAFCAFC2FEF8C6FC0FFEE35F3CC07CF5FB8ACC
C3CFE3070D1ACC90E3FFFFF0E5EFF0CAEBFEB0337DF5BFFFE2CE2E3F27F976FC0F7F8BBF838EBD
7D0CFF33A0F8BFB3CE8DEBBEBE87FF3517FB7DFC9C7DEBBEBBA3C7C3BDDFC4DF9EBB3700'H
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type rRNA,
                    ext name "  fo::o~,;  "
                  },
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  }
                },
                {
                  data gene {
                    locus "  fo;;o~,;  ",
                    allele "  ba,,r.,~; ",
                    desc " waka,~,;. ",
                    maploc " zip;;zip~,; ",
                    syn {
                      "  a;;b;,;,;  ",
                      "  c::d;,;,;,. "
                    },
                    locus-tag " a;;b "
                  },
                  comment " comm;;ent;,~ ",
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  },
                  qual {
                    {
                      qual "satellite",
                      val " unknown;;value ;,;~~"
                    },
                    {
                      qual "  bad;;kname;,;,  ",
                      val " weird;;value;.,.;., "
                    }
                  },
                  title " tit;;le ;,;,; ",
                  except-text " except;;text,;,, "
                },
                {
                  data region "   zip;;py,;~ ",
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  },
                  dbxref {
                    {
                      db "  a::b,;~ ",
                      tag str "  c;;d;~, "
                    }
                  }
                },
                {
                  data imp {
                    key "  bad;;keyname;,;, ",
                    loc "  has;; loc;,;, ",
                    descr " descr;,;,;  "
                  },
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  }
                },
                {
                  data pub {
                    pub {
                      gen {
                        cit "Unpublished",
                        authors {
                          names std {
                            {
                              name name {
                                last "  Bollin  ",
                                first "  Colleen  ",
                                initials "  C.J.  "
                              }
                            }
                          },
                          affil std {
                            affil "  inst  ",
                            div "  dept  ",
                            city "  city  ",
                            sub "  state  ",
                            country "  country  ",
                            street "  address  ",
                            email "  email  ",
                            fax "  fax  ",
                            phone "  phone  ",
                            postal-code "  code  "
                          }
                        },
                        title "  one unpublished pub  "
                      }
                    },
                    name "  pubdesc has a name;,;,  ",
                    comment "  pubdesc;; has a comment;,;,  "
                  },
                  comment "additional comment for pub feature",
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  }
                },
                {
                  data cdregion {
                    code {
                      id 1
                    }
                  },
                  product whole local str "EZ000163_1",
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "EZ000163_1"
          },
          inst {
            repr raw,
            mol aa,
            length 183,
            seq-data ncbieaa "-IVLKDFV*FNLFNVSVTLVNRGSV*VRK**GFDILICLFGS*ACWCC
LYYSWSVGWIYRFRFKFVDTFKFL*SLL*TYSL*GI*LFDN*SRYSNDFFF*CLF**VVLVNIFFRFF*V*VI*LCLV
*IL*VFE*WFLQYFIWN*VCIMDLVLVGLFIHLCLL*LLLVLVWIT*CSLYILLVYL"
          },
          annot {
            {
              data ftable {
                {
                  data prot {
                    name {
                      "  foo;;bar;,;,. ",
                      "  bar::foo;,;,; "
                    },
                    desc "  prot;;desc;,;, ",
                    ec {
                      "  1;;2::3,,4,;,;, ",
                      "  5;;6::7,,8;,;,,. "
                    },
                    activity {
                      "  activ;;ity1;,;, ",
                      "  activ;;ity2;,;,. "
                    }
                  },
                  location int {
                    from 0,
                    to 182,
                    id local str "EZ000163_1"
                  }
                }
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np_feat_nuc"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np_feat_prot"
          },
          descr {
            molinfo {
              completeness complete
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        },
        seq {
          id {
            local str "np_feat_prot2"
          },
          descr {
            molinfo {
              completeness complete
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        },
        seq {
          id {
            local str "np_feat_prot3"
          },
          descr {
            molinfo {
              completeness complete
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat_prot",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat_nuc",
                fuzz-to lim gt
              }
            },
            {
              data cdregion {
                code {
                  id 1
                },
                code-break {
                  {
                    loc int {
                      from 20,
                      to 30,
                      strand plus,
                      id local str "np_feat_nuc"
                    },
                    aa ncbieaa 27
                  }
                }
              },
              product whole local str "np_feat_prot2",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat_nuc",
                fuzz-from lim lt
              }
            },
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat_prot3",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat_nuc",
                fuzz-from lim lt,
                fuzz-to lim gt
              }
            },
            {
              data rna {
                type tRNA,
                ext tRNA {
                  anticodon mix {
                    int {
                      from 20,
                      to 25,
                      strand plus,
                      id local str "np_feat_nuc"
                    },
                    int {
                      from 25,
                      to 30,
                      strand minus,
                      id local str "np_feat_nuc"
                    }
                  }
                }
              },
              location mix {
                int {
                  from 0,
                  to 3,
                  strand plus,
                  id local str "np_feat_nuc"
                },
                int {
                  from 6,
                  to 9,
                  strand minus,
                  id local str "np_feat_nuc"
                }
              }
            },
            {
              data rna {
                type tRNA,
                ext tRNA {
                  anticodon mix {
                    int {
                      from 20,
                      to 25,
                      strand plus,
                      id local str "np_feat_nuc"
                    },
                    int {
                      from 25,
                      to 30,
                      id local str "np_feat_nuc"
                    }
                  }
                }
              },
              location mix {
                int {
                  from 0,
                  to 3,
                  strand plus,
                  id local str "np_feat_nuc"
                },
                int {
                  from 6,
                  to 9,
                  id local str "np_feat_nuc"
                }
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np_feat2_nuc"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np_feat2_prot"
          },
          descr {
            molinfo {
              completeness no-left
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat2_prot",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat2_nuc",
                fuzz-to lim gt
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np_feat3_nuc"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np_feat3_prot"
          },
          descr {
            molinfo {
              completeness no-right
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat3_prot",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat3_nuc",
                fuzz-from lim lt
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np_feat4_nuc"
          },
          inst {
            repr raw,
            mol dna,
            length 16,
            seq-data iupacna "AATTGGCCAATTGGCC"
          }
        },
        seq {
          id {
            local str "np_feat4_prot1"
          },
          descr {
            molinfo {
              completeness no-ends
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        },
        seq {
          id {
            local str "np_feat4_prot2"
          },
          descr {
            molinfo {
              completeness no-ends
            }
          },
          inst {
            repr raw,
            mol aa,
            length 5,
            seq-data ncbieaa "LMMLP"
          }
        },
        seq {
          id {
            local str "np_feat4_prot3"
          },
          descr {
            molinfo {
              completeness no-ends
            }
          },
          inst {
            repr raw,
            mol aa,
            length 4,
            seq-data ncbieaa "LMML"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat4_prot1",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat4_nuc",
                fuzz-from lim lt
              }
            },
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat4_prot2",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat4_nuc",
                fuzz-to lim gt
              }
            },
            {
              data cdregion {
                code {
                  id 1
                }
              },
              product whole local str "np_feat4_prot3",
              location int {
                from 0,
                to 15,
                strand plus,
                id local str "np_feat4_nuc"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        other {
          accession "NT_123456"
        }
      },
      inst {
        repr raw,
        mol dna,
        length 187,
        seq-data iupacna "ATGAAATTTGGGCCCAAATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCA
AACCCAAAATGAAATTTGGGCCCAAATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCAAACCCAAAATGAAATTTG
GGCCCAAATTTGGGCCCCCCAAAGGGCCCCCCAAAGGGCCCAAACCCAAAAAAAAAA"
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              comment "cds on NT_ sequence without product should not produce
 error",
              location int {
                from 0,
                to 186,
                strand plus,
                id other {
                  accession "NT_123456"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        other {
          accession "NG_123456"
        }
      },
      inst {
        repr raw,
        mol dna,
        length 186,
        seq-data ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7A
BB82644586A862264CA3A67FC8C7D4B7D63BEE3648'H
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              comment "cds on NG_ sequence without product should not produce
 error",
              location int {
                from 0,
                to 186,
                strand plus,
                id other {
                  accession "NG_123456"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        other {
          accession "NW_123456"
        }
      },
      inst {
        repr raw,
        mol dna,
        length 187,
        seq-data ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7A
BB82644586A862264CA3A67FC8C7D4B7D63BEE3648'H
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
                code {
                  id 1
                }
              },
              comment "cds on NW_ sequence without product should not produce
 error",
              location int {
                from 0,
                to 186,
                strand plus,
                id other {
                  accession "NW_123456"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat2"
      },
      inst {
        repr raw,
        mol dna,
        length 187,
        seq-data ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7A
BB82644586A862264CA3A67FC8C7D4B7D63BEE3648'H
      },
      annot {
        {
          data ftable {
            {
              data gene {
              },
              location int {
                from 0,
                to 30,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data rna {
                type unknown,
                ext name "misplaced"
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "not recognized"
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat2"
              },
              qual {
                {
                  qual "not recognized",
                  val "something"
                },
                {
                  qual "",
                  val "null qual name"
                }
              }
            },
            {
              data imp {
                key "conflict"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "misc_binding"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "modified_base"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "old_sequence"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "operon"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "protein_bind"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data imp {
                key "protein_bind"
              },
              location int {
                from 0,
                to 548,
                strand plus,
                id local str "feat2"
              }
            },
            {
              data gene {
              },
              location mix {
                int {
                  from 0,
                  to 4,
                  strand plus,
                  id local str "badinst1"
                },
                int {
                  from 5,
                  to 9,
                  strand plus,
                  id genbank {
                    accession "M65061.1"
                  }
                }
              }
            },
            {
              data cdregion {
              },
              product whole local str "seq_not_present",
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat2"
              },
              pseudo TRUE
            },
            {
              data cdregion {
                code {
                  id 1
                }
              },
              comment "This should produce an error",
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat2"
              },
              qual {
                {
                  qual "transl_except",
                  val "unparseable foo"
                },
                {
                  qual "exception",
                  val "unparseable exception qual"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "feat3"
      },
      inst {
        repr raw,
        mol dna,
        length 187,
        seq-data ncbi2na '87BA09189F130BAF2909E9BBA1FBBA8EAE4ADE4CC0D3BD7ABF7A
BB82644586A862264CA3A67FC8C7D4B7D63BEE3648'H
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type tRNA,
                ext tRNA {
                  aa iupacaa 1,
                  codon {
                    0,
                    1,
                    2
                  },
                  anticodon int {
                    from 5,
                    to 7,
                    strand plus,
                    id local str "feat3"
                  }
                }
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat3"
              }
            },
            {
              data rna {
                type tRNA,
                ext tRNA {
                  aa iupacaa 1,
                  codon {
                    0,
                    1,
                    2
                  },
                  anticodon int {
                    from 5,
                    to 7,
                    strand plus,
                    id local str "feat3"
                  }
                }
              },
              except TRUE,
              location int {
                from 50,
                to 186,
                strand plus,
                id local str "feat3"
              },
              except-text "RNA editing"
            },
            {
              data imp {
                key "misc_feature"
              },
              comment "strands: both, both-rev",
              location mix {
                int {
                  from 0,
                  to 3,
                  strand both,
                  id local str "feat3"
                },
                int {
                  from 6,
                  to 9,
                  strand both-rev,
                  id local str "feat3"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              comment "strands: both, both",
              location mix {
                int {
                  from 0,
                  to 3,
                  strand both,
                  id local str "feat3"
                },
                int {
                  from 6,
                  to 9,
                  strand both,
                  id local str "feat3"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              comment "strands: both-rev, both-rev",
              location mix {
                int {
                  from 0,
                  to 3,
                  strand both-rev,
                  id local str "feat3"
                },
                int {
                  from 6,
                  to 9,
                  strand both-rev,
                  id local str "feat3"
                }
              }
            },
            {
              data gene {
                locus "redundant"
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat3"
              }
            },
            {
              data cdregion {
                code-break {
                  {
                    loc int {
                      from 1,
                      to 3,
                      strand plus,
                      id local str "feat3"
                    },
                    aa ncbieaa 27
                  }
                }
              },
              location int {
                from 0,
                to 186,
                strand plus,
                id local str "feat3"
              },
              xref {
                {
                  data gene {
                    locus "redundant"
                  }
                }
              }
            }
          }
        }
      }
    },
    set {
      class gibb,
      seq-set {
      }
    },
    set {
      class nuc-prot,
      seq-set {
        set {
          class phy-set,
          seq-set {
          }
        }
      }
    },
    set {
      class parts,
      seq-set {
        seq {
          id {
            local str "pkg3"
          },
          inst {
            repr raw,
            mol dna,
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type rRNA,
                    ext name "misplaced"
                  },
                  location int {
                    from 0,
                    to 548,
                    strand plus,
                    id genbank {
                      accession "EZ000163",
                      version 1
                    }
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "pkg4"
          },
          inst {
            repr raw,
            mol aa,
            length 10,
            seq-data iupacaa "AATTGGCCAA"
          }
        },
        set {
          class parts,
          seq-set {
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "np_feat5"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCCAANNAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data imp {
                    key "repeat_region"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "np_feat5"
                  },
                  qual {
                    {
                      qual "rpt_unit_seq",
                      val "aa"
                    }
                  }
                },
                {
                  data imp {
                    key "repeat_region"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "np_feat5"
                  },
                  qual {
                    {
                      qual "rpt_unit_seq",
                      val "gggg"
                    }
                  }
                },
                {
                  data imp {
                    key "mat_peptide"
                  },
                  location int {
                    from 1,
                    to 3,
                    strand plus,
                    id local str "np_feat5"
                  },
                  qual {
                    {
                      qual "product",
                      val "this mat_peptide is not on a codon boundary"
                    }
                  }
                },
                {
                  data imp {
                    key "repeat_region"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "np_feat5"
                  },
                  qual {
                    {
                      qual "rpt_unit_seq",
                      val "zzzzzz"
                    },
                    {
                      qual "rpt_unit_range",
                      val "bad value"
                    },
                    {
                      qual "rpt_unit_range",
                      val "50..60"
                    },
                    {
                      qual "rpt_unit_seq",
                      val "12345"
                    }
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "np_feat5_prot"
          },
          descr {
            molinfo {
              biomol peptide
            }
          },
          inst {
            repr raw,
            mol aa,
            length 24,
            seq-data iupacaa "AATTGGCCAANNAATTGGCCTTCC"
          },
          annot {
            {
              data ftable {
                {
                  data prot {
                    name {
                      "overlap1"
                    },
                    processed signal-peptide
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "np_feat5_prot"
                  }
                },
                {
                  data prot {
                    name {
                      "overlap2"
                    },
                    processed mature
                  },
                  location int {
                    from 4,
                    to 12,
                    strand plus,
                    id local str "np_feat5_prot"
                  }
                }
              }
            }
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "variation"
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "np_feat5"
              },
              qual {
                {
                  qual "replace",
                  val "AATTGG"
                }
              }
            },
            {
              data cdregion {
              },
              comment "[12346]",
              product whole local str "np_feat5_prot",
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "mat_peptide"
              },
              location int {
                from 1,
                to 2,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "sig_peptide"
              },
              location int {
                from 0,
                to 3,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "transit_peptide"
              },
              location int {
                from 1,
                to 3,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data cdregion {
                frame two
              },
              comment "[12346]",
              product whole local str "np_feat5_prot",
              location int {
                from 6,
                to 10,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "mat_peptide"
              },
              location int {
                from 6,
                to 9,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "sig_peptide"
              },
              location int {
                from 7,
                to 8,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "transit_peptide"
              },
              location int {
                from 6,
                to 8,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data cdregion {
                frame three
              },
              comment "[12346]",
              product whole local str "np_feat5_prot",
              location int {
                from 11,
                to 15,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "mat_peptide"
              },
              location int {
                from 12,
                to 15,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "sig_peptide"
              },
              location int {
                from 13,
                to 14,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data imp {
                key "transit_peptide"
              },
              location int {
                from 12,
                to 14,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data cdregion {
                frame two
              },
              comment "[12346]",
              product whole local str "np_feat5_prot",
              location int {
                from 16,
                to 20,
                strand plus,
                id local str "np_feat5",
                fuzz-from lim lt,
                fuzz-to lim gt
              }
            },
            {
              data imp {
                key "mat_peptide"
              },
              location int {
                from 18,
                to 20,
                strand plus,
                id local str "np_feat5",
                fuzz-to lim gt
              }
            },
            {
              data imp {
                key "sig_peptide"
              },
              location int {
                from 16,
                to 18,
                strand plus,
                id local str "np_feat5",
                fuzz-from lim lt
              }
            },
            {
              data imp {
                key "transit_peptide"
              },
              location int {
                from 18,
                to 18,
                strand plus,
                id local str "np_feat5"
              }
            },
            {
              data cdregion {
              },
              comment "[12345]",
              product whole local str "np_feat5_prot",
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "np_feat5"
              }
            }
          }
        }
      }
    },
    set {
      class genbank,
      seq-set {
        seq {
          id {
            local str "mrna_1"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCCAANNAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "bad mrna gene1"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  product whole local str "mrna_2",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data gene {
                    locus "bad mrna gene1"
                  },
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  product whole local str "mrna_2",
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data gene {
                    locus "bad mrna gene3"
                  },
                  location int {
                    from 16,
                    to 20,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  product whole local str "mrna_2",
                  location int {
                    from 18,
                    to 23,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data imp {
                    key "polyA_site"
                  },
                  location mix {
                    int {
                      from 18,
                      to 20,
                      strand plus,
                      id local str "mrna_1"
                    },
                    int {
                      from 21,
                      to 23,
                      strand plus,
                      id local str "mrna_1"
                    }
                  },
                  cit pub {
                    equiv {
                      gen {
                        cit "blah"
                      },
                      gen {
                        cit "foo"
                      }
                    }
                  }
                },
                {
                  data imp {
                    key "polyA_signal"
                  },
                  location int {
                    from 18,
                    to 18,
                    strand plus,
                    id local str "mrna_1"
                  }
                },
                {
                  data cdregion {
                  },
                  product whole local str "mrna_2",
                  location mix {
                    int {
                      from 12,
                      to 20,
                      strand plus,
                      id local str "mrna_1"
                    },
                    int {
                      from 12,
                      to 20,
                      strand plus,
                      id local str "mrna_1"
                    }
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "gene_1"
          },
          inst {
            repr raw,
            mol rna,
            length 24,
            seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "gene2"
                  },
                  product whole genbank {
                    name "gene_product",
                    version 1
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "gene_1"
                  }
                },
                {
                  data gene {
                    locus "gene3",
                    locus-tag "bad locus tag"
                  },
                  product whole local str "gene_1",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "gene_1"
                  }
                },
                {
                  data gene {
                    locus "gene1",
                    locus-tag "bad locus tag"
                  },
                  product whole genbank {
                    name "EZ000163",
                    version 1
                  },
                  location mix {
                    int {
                      from 0,
                      to 5,
                      strand plus,
                      id local str "gene_1"
                    },
                    int {
                      from 10,
                      to 15,
                      strand plus,
                      id local str "gene_1"
                    }
                  },
                  qual {
                    {
                      qual "old_locus_tag",
                      val "bad locus tag"
                    },
                    {
                      qual "old_locus_tag",
                      val "multiple,old,locus-tags"
                    }
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            genbank {
              name "EZ000163",
              version 1
            }
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 24,
            seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
          }
        },
        seq {
          id {
            genbank {
              name "gene_product",
              version 1
            }
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 24,
            seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
          }
        },
        seq {
          id {
            local str "mrna_2"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 24,
            seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
          }
        }
      }
    },
    set {
      class genbank,
      seq-set {
        seq {
          id {
            local str "mrna_4"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCCAANNAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature with an exception"
                  },
                  except TRUE,
                  product whole local str "mrna_6",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_4"
                  },
                  except-text "transcribed product replaced"
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature with an exception"
                  },
                  except TRUE,
                  product whole local str "mrna_6",
                  location int {
                    from 0,
                    to 8,
                    strand plus,
                    id local str "mrna_4"
                  },
                  except-text "unclassified transcription discrepancy"
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature with an exception"
                  },
                  except TRUE,
                  product whole local str "mrna_5",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_4"
                  },
                  except-text "RNA editing"
                }
              }
            }
          }
        },
        seq {
          id {
            local str "mrna_5"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 6,
            seq-data iupacna "AATTGG"
          }
        },
        seq {
          id {
            local str "mrna_6"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 9,
            seq-data iupacna "AATTGGCAC"
          }
        }
      }
    },
    set {
      class genbank,
      seq-set {
        seq {
          id {
            local str "mrna_7"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCCAANNAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  product whole local str "mrna_8",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_7"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  product whole local str "mrna_9",
                  location int {
                    from 6,
                    to 11,
                    strand plus,
                    id local str "mrna_7"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "mrna_8"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 13,
            seq-data iupacna "AATTGAAAAAAAA"
          }
        },
        seq {
          id {
            local str "mrna_9"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 27,
            seq-data iupacna "CCAANNAATAAAAAAAAAAAAAAAAAA"
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "mrna_10"
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "gene not overlapping anything"
                  },
                  location int {
                    from 16,
                    to 18,
                    strand plus,
                    id local str "mrna_10"
                  }
                },
                {
                  data imp {
                    key "repeat_region"
                  },
                  location int {
                    from 19,
                    to 20,
                    strand plus,
                    id local str "mrna_10"
                  }
                },
                {
                  id local str "foo2",
                  data rna {
                    type mRNA,
                    ext name "overlap1"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_10"
                  }
                },
                {
                  id local str "bar2",
                  data rna {
                    type mRNA,
                    ext name "overlap2"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_10"
                  },
                  xref {
                    {
                      id local str "baz2"
                    }
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "overlap1"
                  },
                  product whole local str "mrna_11",
                  location int {
                    from 6,
                    to 10,
                    strand plus,
                    id local str "mrna_10"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "overlap2"
                  },
                  product whole local str "mrna_11",
                  location int {
                    from 6,
                    to 10,
                    strand plus,
                    id local str "mrna_10"
                  }
                }
              }
            }
          }
        }
      },
      annot {
        {
          data ftable {
            {
              id local str "baz2",
              data cdregion {
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "mrna_10"
              },
              xref {
                {
                  id local str "bar2"
                }
              }
            },
            {
              id local id 1,
              data cdregion {
              },
              location int {
                from 6,
                to 10,
                strand plus,
                id local str "mrna_10"
              }
            },
            {
              id local id 1,
              data cdregion {
              },
              location int {
                from 11,
                to 15,
                strand plus,
                id local str "mrna_10"
              }
            },
            {
              id local id 1,
              data cdregion {
              },
              location int {
                from 19,
                to 20,
                strand plus,
                id local str "mrna_10"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "mrna_12"
          },
          inst {
            repr raw,
            mol dna,
            length 48,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "gene not overlapping anything"
                  },
                  location int {
                    from 0,
                    to 2,
                    strand plus,
                    id local str "mrna_12"
                  }
                },
                {
                  data rna {
                    type mRNA,
                    ext name "mrna not overlapping anything"
                  },
                  location int {
                    from 3,
                    to 5,
                    strand plus,
                    id local str "mrna_12"
                  }
                }
              }
            }
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
              },
              location int {
                from 6,
                to 8,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 6,
                to 8,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 9,
                to 11,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 9,
                to 11,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 12,
                to 14,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 12,
                to 14,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 15,
                to 17,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 18,
                to 20,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 21,
                to 23,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 24,
                to 26,
                strand plus,
                id local str "mrna_12"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 27,
                to 29,
                strand plus,
                id local str "mrna_12"
              }
            }
          }
        }
      }
    },
    set {
      class genbank,
      seq-set {
        seq {
          id {
            local str "mrna_13"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCCAANNAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data rna {
                    type mRNA,
                    ext name "an mRNA feature"
                  },
                  except TRUE,
                  product whole local str "mrna_14",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "mrna_13"
                  },
                  except-text "RNA editing"
                }
              }
            }
          }
        },
        seq {
          id {
            local str "mrna_14"
          },
          descr {
            molinfo {
              biomol genomic
            }
          },
          inst {
            repr raw,
            mol rna,
            length 6,
            seq-data iupacna "AATTGG"
          }
        }
      }
    },
    seq {
      id {
        local str "trna_1"
      },
      inst {
        repr raw,
        mol rna,
        length 24,
        seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type tRNA,
                ext tRNA {
                  aa iupacaa 255,
                  codon {
                    200
                  },
                  anticodon int {
                    from 5,
                    to 7,
                    strand plus,
                    id local str "feat3"
                  }
                }
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "trna_1"
              }
            },
            {
              data rna {
                type tRNA,
                ext tRNA {
                  aa iupacaa 200,
                  codon {
                    100
                  },
                  anticodon int {
                    from 5,
                    to 7,
                    strand plus,
                    id local str "feat3"
                  }
                }
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "trna_1"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "mrna_3"
      },
      inst {
        repr raw,
        mol rna,
        length 24,
        seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "wrong number"
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "mrna_3"
              }
            },
            {
              data rna {
                type mRNA,
                ext name "wrong number"
              },
              location int {
                from 0,
                to 10,
                strand plus,
                id local str "mrna_3"
              }
            },
            {
              data rna {
                type mRNA,
                ext name "wrong number"
              },
              location int {
                from 15,
                to 20,
                strand plus,
                id local str "mrna_3"
              }
            },
            {
              data cdregion {
              },
              location int {
                from 15,
                to 20,
                strand plus,
                id local str "mrna_3"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "cds_1"
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  data imp {
                    key "5'UTR"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "cds_1"
                  }
                },
                {
                  data cdregion {
                    conflict TRUE,
                    code-break {
                      {
                        loc int {
                          from 0,
                          to 3,
                          strand plus,
                          id local str "cds_1"
                        },
                        aa ncbieaa 10
                      },
                      {
                        loc int {
                          from 0,
                          to 3,
                          strand plus,
                          id local str "cds_1"
                        },
                        aa ncbieaa 15
                      }
                    }
                  },
                  product whole local str "cds_1_prot1",
                  location int {
                    from 7,
                    to 15,
                    strand plus,
                    id local str "cds_1"
                  },
                  except-text "RNA editing"
                },
                {
                  data cdregion {
                    conflict TRUE
                  },
                  product whole local str "cds_1_prot2",
                  location int {
                    from 7,
                    to 15,
                    strand plus,
                    id local str "cds_1"
                  }
                },
                {
                  data imp {
                    key "3'UTR"
                  },
                  location int {
                    from 19,
                    to 23,
                    strand plus,
                    id local str "cds_1"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "cds_1_prot1"
          },
          inst {
            repr raw,
            mol aa,
            length 3,
            seq-data iupacaa "MLI"
          }
        },
        seq {
          id {
            local str "cds_1_prot2"
          },
          inst {
            repr raw,
            mol aa,
            length 3,
            seq-data iupacaa "RLI"
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "cds_2"
          },
          inst {
            repr raw,
            mol dna,
            length 26,
            seq-data iupacna "AATGGCTTTAGCTATTTCTGAATAGA"
          },
          annot {
            {
              data ftable {
                {
                  data gene {
                    locus "pseudogene"
                  },
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  pseudo TRUE
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  pseudo TRUE
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  except-text "unclassified translation discrepancy"
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  except-text "mismatches in translation"
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  except-text "artificial frameshift"
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  except-text "rearrangement required for product"
                },
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "cds_2_prot1",
                  location int {
                    from 1,
                    to 24,
                    strand plus,
                    id local str "cds_2"
                  },
                  except-text "translated product replaced"
                }
              }
            }
          }
        },
        seq {
          id {
            local str "cds_2_prot1"
          },
          inst {
            repr raw,
            mol aa,
            length 7,
            seq-data iupacaa "MALAISE"
          }
        },
        seq {
          id {
            local str "cds_2_prot2"
          },
          inst {
            repr raw,
            mol aa,
            length 3,
            seq-data iupacaa "RLI"
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            gibbmt 5
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  id local str "foo",
                  data rna {
                    type mRNA,
                    ext name "overlap1"
                  },
                  location int {
                    from 0,
                    to 23,
                    strand plus,
                    id gibbmt 5
                  }
                },
                {
                  id local str "bar",
                  data rna {
                    type mRNA,
                    ext name "overlap2"
                  },
                  location int {
                    from 0,
                    to 23,
                    strand plus,
                    id gibbmt 5
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            other {
              accession "will_not_match"
            }
          },
          inst {
            repr raw,
            mol aa,
            length 3,
            seq-data iupacaa "MLI"
          },
          annot {
            {
              data ftable {
                {
                  data prot {
                    name {
                      "hypothetical protein XP_123456]"
                    }
                  },
                  location int {
                    from 0,
                    to 2,
                    strand plus,
                    id other {
                      accession "will_not_match"
                    }
                  }
                }
              }
            }
          }
        }
      },
      annot {
        {
          data ftable {
            {
              id local str "baz",
              data cdregion {
              },
              product whole other {
                accession "will_not_match"
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id gibbmt 5
              }
            }
          }
        }
      }
    },
    seq {
      id {
        general {
          db "foo",
          tag str "gene_2"
        }
      },
      inst {
        repr raw,
        mol rna,
        length 24,
        seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus-tag "won't match general ID"
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id general {
                  db "foo",
                  tag str "gene_2"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "gene_3"
      },
      descr {
        pub {
          pub {
            article {
              title {
                name "A conservative test of genetic drift in the
 endosymbiotic bacterium Buchnera:  slightly delterious mutations in the
 chaperonin groEL"
              },
              authors {
                names std {
                  {
                    name name {
                      last "Herbeck",
                      first "Joshua",
                      initials "J.T."
                    }
                  },
                  {
                    name name {
                      last "Funk",
                      first "Daniel",
                      initials "D.J."
                    }
                  },
                  {
                    name name {
                      last "Degnan",
                      first "Patrick",
                      initials "P.H."
                    }
                  },
                  {
                    name name {
                      last "Wernegreen",
                      first "Jennifer",
                      initials "J.J."
                    }
                  }
                },
                affil std {
                  affil "Marine Biological Laboratory",
                  div "Josephine Bay Paul Center",
                  city "Woods Hole",
                  sub "MA",
                  country "USA",
                  street "7 MBL Street",
                  postal-code "02543"
                }
              },
              from journal {
                title {
                  iso-jta "Genetics"
                },
                imp {
                  date str "?",
                  prepub in-press
                }
              }
            },
            pmid 1234
          }
        }
      },
      inst {
        repr raw,
        mol rna,
        length 24,
        seq-data iupacna "AAUUGGCCAANNAAUUGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "A"
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "gene_3"
              },
              cit pub {
                muid 81077261
              }
            },
            {
              data gene {
                locus "B"
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "gene_3"
              },
              cit pub {
                pmid 81077261,
                gen {
                  cit "blah"
                },
                gen {
                  cit "Herbeck,J.T. (?) Genetics |ActogditebBsdmitcg"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "gene_3"
              }
            },
            {
              data gene {
                locus "B"
              },
              location int {
                from 10,
                to 15,
                strand plus,
                id local str "gene_3"
              }
            },
            {
              data gene {
                locus "B"
              },
              location int {
                from 10,
                to 15,
                strand plus,
                id local str "gene_3"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              comment "nested seqlocmix",
              location mix {
                mix {
                  int {
                    from 0,
                    to 3,
                    strand plus,
                    id gi 2
                  },
                  int {
                    from 5,
                    to 8,
                    strand plus,
                    id local str "gene_3"
                  }
                },
                int {
                  from 10,
                  to 15,
                  strand plus,
                  id gi 2
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 10,
                to 15,
                strand plus,
                id local str "gene_3"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "src_feat"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data pub {
                pub {
                  gen {
                    cit "This is a cit-gen with a bad date.",
                    authors {
                      names str {
                        "An unstructured name"
                      }
                    },
                    date std {
                      year 2038,
                      month 13
                    },
                    title "This is a cit-gen."
                  },
                  pmid 6
                }
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "src_feat"
              }
            },
            {
              data pub {
                pub {
                  gen {
                    cit "This is a cit-gen with a bad date.",
                    authors {
                      names str {
                        "An unstructured name"
                      }
                    },
                    date std {
                      year 2038,
                      month 13
                    },
                    title "This is a cit-gen."
                  },
                  pmid 6
                }
              },
              location int {
                from 7,
                to 15,
                strand plus,
                id local str "src_feat"
              }
            },
            {
              data biosrc {
                genome genomic,
                org {
                  taxname "matches",
                  orgname {
                  }
                }
              },
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "src_feat"
              }
            },
            {
              data biosrc {
                genome genomic,
                org {
                  taxname "matches",
                  orgname {
                  }
                }
              },
              location int {
                from 10,
                to 15,
                strand plus,
                id local str "src_feat"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "src_feat2"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data pub {
                pub {
                  gen {
                    cit "This is a cit-gen with a bad date.",
                    authors {
                      names str {
                        "An unstructured name"
                      }
                    },
                    date std {
                      year 2038,
                      month 13
                    },
                    title "This is a cit-gen."
                  },
                  pmid 6
                }
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "src_feat2"
              }
            },
            {
              data pub {
                pub {
                  gen {
                    cit "This is a cit-gen with a bad date.",
                    authors {
                      names str {
                        "An unstructured name"
                      }
                    },
                    date std {
                      year 2038,
                      month 13
                    },
                    title "This is a cit-gen."
                  },
                  pmid 6
                }
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "src_feat2"
              }
            },
            {
              data biosrc {
                genome genomic,
                org {
                  taxname "matches",
                  orgname {
                  }
                }
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "src_feat2"
              }
            },
            {
              data biosrc {
                genome genomic,
                org {
                  taxname "matches",
                  orgname {
                  }
                }
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "src_feat2"
              }
            },
            {
              data biosrc {
                genome genomic,
                org {
                  taxname "matches",
                  orgname {
                  }
                }
              },
              location int {
                from 0,
                to 23,
                strand plus,
                id local str "src_feat2"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "redundant_fields"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "this matches comment"
              },
              comment "this matches comment",
              location bond {
                a {
                  point 0,
                  strand plus,
                  id local str "redundant_fields"
                },
                b {
                  point 3,
                  strand plus,
                  id local str "redundant_fields"
                }
              }
            },
            {
              data gene {
                locus-tag "this matches comment"
              },
              comment "this matches comment",
              location int {
                from 6,
                to 10,
                strand plus,
                id local str "redundant_fields"
              }
            },
            {
              data gene {
                locus-tag "this matches old_locus_tag"
              },
              location int {
                from 6,
                to 10,
                strand plus,
                id local str "redundant_fields"
              },
              qual {
                {
                  qual "old_locus_tag",
                  val "this matches old_locus_tag"
                }
              }
            },
            {
              data het "heterogen feature 1",
              location bond {
                a {
                  point 0,
                  strand plus,
                  id local str "redundant_fields"
                },
                b {
                  point 3,
                  strand plus,
                  id local str "redundant_fields"
                }
              },
              xref {
                {
                  data gene {
                    locus "will not find this locus"
                  }
                }
              }
            },
            {
              data het "heterogen feature 2",
              location bond {
                a {
                  point 0,
                  strand plus,
                  id local str "redundant_fields"
                }
              },
              xref {
                {
                  data gene {
                    locus-tag "will not find this locus-tag"
                  }
                }
              }
            },
            {
              data bond thioether,
              location bond {
                a {
                  point 0,
                  strand plus,
                  id local str "redundant_fields"
                },
                b {
                  point 3,
                  strand plus,
                  id local str "redundant_fields"
                }
              }
            },
            {
              data prot {
                name {
                  "this matches comment"
                }
              },
              comment "this matches comment",
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "redundant_fields"
              }
            },
            {
              data prot {
                desc "this matches comment"
              },
              comment "this matches comment",
              location int {
                from 0,
                to 5,
                strand plus,
                id local str "redundant_fields"
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "bad_xrefs"
          },
          inst {
            repr raw,
            mol dna,
            length 24,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
          },
          annot {
            {
              data ftable {
                {
                  id local id 2,
                  data gene {
                    locus "gene for bad xrefs"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "bad_xrefs"
                  },
                  xref {
                    {
                      id local id 3
                    }
                  }
                },
                {
                  id local id 3,
                  data gene {
                    locus "gene for bad xrefs"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "bad_xrefs"
                  },
                  xref {
                    {
                      id local id 2
                    }
                  }
                },
                {
                  id local id 4,
                  data cdregion {
                  },
                  product whole gi 123457,
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "bad_xrefs"
                  },
                  xref {
                    {
                      id local id 5
                    }
                  }
                },
                {
                  id local id 5,
                  data rna {
                    type mRNA,
                    ext name "conflicting mrna"
                  },
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "bad_xrefs"
                  },
                  ext {
                    type str "MrnaProteinLink",
                    data {
                      {
                        label str "protein seqID",
                        data str "gi|654321"
                      }
                    }
                  },
                  xref {
                    {
                      id local id 4
                    }
                  }
                },
                {
                  data gene {
                    locus "gene for bad xrefs"
                  },
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "bad_xrefs"
                  }
                },
                {
                  id local id 6,
                  data gene {
                    locus "gene for bad xrefs"
                  },
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "bad_xrefs"
                  },
                  xref {
                    {
                      id local id 7
                    }
                  }
                },
                {
                  id local id 7,
                  data gene {
                    locus "gene for bad xrefs"
                  },
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "bad_xrefs"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            gi 123457
          },
          inst {
            repr raw,
            mol aa,
            length 24,
            seq-data iupacaa "AATTGGCATGTTAATTGGCCAANN"
          }
        }
      }
    },
    seq {
      id {
        local str "gene_xrefs"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "match_on_locus"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id local str "gene_xrefs"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id local str "gene_xrefs"
              },
              qual {
                {
                  qual "allele",
                  val "not a match"
                }
              },
              xref {
                {
                  data gene {
                    locus "match_on_locus",
                    allele "bad match"
                  }
                }
              }
            },
            {
              data gene {
                locus "map by overlap",
                allele "no match for allele"
              },
              location int {
                from 3,
                to 5,
                strand plus,
                id local str "gene_xrefs"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 3,
                to 5,
                strand plus,
                id local str "gene_xrefs"
              },
              qual {
                {
                  qual "allele",
                  val "bad match"
                }
              }
            },
            {
              data gene {
                locus "match_on_locus"
              },
              location int {
                from 6,
                to 8,
                strand plus,
                id local str "gene_xrefs"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 6,
                to 8,
                strand plus,
                id local str "gene_xrefs"
              },
              qual {
                {
                  qual "allele",
                  val "redundant allele"
                }
              },
              xref {
                {
                  data gene {
                    locus "match_on_locus",
                    allele "redundant allele"
                  }
                }
              }
            },
            {
              data gene {
                locus "map by overlap",
                allele "redundant allele"
              },
              location int {
                from 9,
                to 11,
                strand plus,
                id local str "gene_xrefs"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 9,
                to 11,
                strand plus,
                id local str "gene_xrefs"
              },
              qual {
                {
                  qual "allele",
                  val "redundant allele"
                }
              }
            },
            {
              data gene {
                locus "has locus",
                locus-tag "has locus tag"
              },
              location int {
                from 12,
                to 14,
                strand plus,
                id local str "gene_xrefs"
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 12,
                to 14,
                strand plus,
                id local str "gene_xrefs"
              },
              xref {
                {
                  data gene {
                    locus-tag "has locus tag"
                  }
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        other {
          accession "NC_111111"
        }
      },
      descr {
        source {
          org {
            taxname "Drosophila melanogaster"
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "a"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id other {
                  accession "NC_111111"
                }
              }
            },
            {
              data gene {
                locus "b"
              },
              location int {
                from 0,
                to 2,
                strand minus,
                id other {
                  accession "NC_111111"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id other {
                  accession "NC_111111"
                }
              },
              xref {
                {
                  data gene {
                    locus "match_on_locus"
                  }
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "oldlocustag"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data gene {
                locus "match_on_locus"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id local str "oldlocustag"
              },
              qual {
                {
                  qual "old_locus_tag",
                  val "value 1"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 2,
                strand plus,
                id local str "oldlocustag"
              },
              qual {
                {
                  qual "old_locus_tag",
                  val "value 2"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "go_terms"
      },
      descr {
        source {
          org {
            taxname "Drosophila melanogaster"
          }
        }
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "tRNA"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "go_terms"
              },
              ext {
                type str "GeneOntology",
                data {
                  {
                    label str "Function",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  },
                  {
                    label str "Process",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  },
                  {
                    label str "Component",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  }
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "go_terms"
              },
              ext {
                type str "GeneOntology",
                data {
                  {
                    label str "Function",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "match_term"
                          },
                          {
                            label str "go id",
                            data str "0000001"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "match_term"
                          },
                          {
                            label str "go id",
                            data str "0000001"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  },
                  {
                    label str "Process",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0000001"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  },
                  {
                    label str "Component",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "unrecognized field",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  }
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "go_terms"
              },
              ext {
                type str "GeneOntology",
                data {
                  {
                    label str "Unrecognized Name",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  }
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "go_terms"
              },
              ext {
                type str "GeneOntology",
                data {
                  {
                    label str "Function",
                    data fields {
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "thiamin diphosphokinase activity"
                          },
                          {
                            label str "go id",
                            data str "0004788"
                          },
                          {
                            label str "evidence",
                            data str "ISS"
                          }
                        }
                      },
                      {
                        label id 0,
                        data fields {
                          {
                            label str "text string",
                            data str "hydrolase activity"
                          },
                          {
                            label str "go id",
                            data str "0016787"
                          },
                          {
                            label str "evidence",
                            data str "IEA"
                          }
                        }
                      }
                    }
                  }
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "inference"
      },
      inst {
        repr raw,
        mol dna,
        length 24,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANN"
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to sequence"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to sequence:a"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to sequence:INSD:AY123456"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to sequence:INSD:AY123456.1"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to AA sequence"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to AA sequence:INSD:AY_123456.1"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to AA sequence:RefSeq:AY_123456.1"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to DNA sequence"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to DNA sequence:INSD:AY999999.9"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to RNA sequence"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to RNA sequence, mRNA"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to RNA sequence, EST"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "similar to RNA sequence, other RNA"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "profile"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "nucleotide motif"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "protein motif"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "ab initio prediction"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "alignment"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "alignment:something:INSD|AY123456"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "alignment:something:INSD|AY123456.1"
                }
              }
            },
            {
              data imp {
                key "misc_feature"
              },
              location int {
                from 0,
                to 9,
                strand plus,
                id local str "inference"
              },
              qual {
                {
                  qual "inference",
                  val "not a valid inference"
                }
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "rrna_its"
      },
      descr {
        molinfo {
          biomol genomic
        }
      },
      inst {
        repr delta,
        mol dna,
        length 630,
        ext delta {
          literal {
            length 100,
            seq-data iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANN
AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "AATTGGCCAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 100,
            seq-data iupacna "AATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCC
AAAATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAAAATTGGCCAA"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 3,
                to 4,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 6,
                to 7,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 9,
                to 10,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "28S ribosomal rRNA"
              },
              location int {
                from 12,
                to 13,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 52,
                to 53,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 49,
                to 50,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 46,
                to 47,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 43,
                to 44,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "28S ribosomal rRNA"
              },
              location int {
                from 40,
                to 41,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 20,
                to 22,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 22,
                to 25,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 25,
                to 28,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 28,
                to 31,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "28S ribosomal rRNA"
              },
              location int {
                from 31,
                to 34,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 91,
                to 94,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 88,
                to 91,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 85,
                to 88,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 82,
                to 85,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "28S ribosomal rRNA"
              },
              location int {
                from 80,
                to 82,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 97,
                to 99,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 200,
                to 202,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 204,
                to 209,
                strand plus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 310,
                to 313,
                strand plus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 315,
                to 319,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 2"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "5.8S ribosomal rRNA"
              },
              location int {
                from 420,
                to 423,
                strand minus,
                id local str "rrna_its"
              }
            },
            {
              data rna {
                type other,
                ext name "misc_RNA"
              },
              location int {
                from 425,
                to 429,
                strand minus,
                id local str "rrna_its"
              },
              qual {
                {
                  qual "product",
                  val "internal transcribed spacer 1"
                }
              }
            },
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 530,
                to 532,
                strand minus,
                id local str "rrna_its"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "FeatureSeqIDCaseDifference"
      },
      descr {
        molinfo {
          biomol genomic
        }
      },
      inst {
        repr raw,
        mol dna,
        length 100,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAATT
GGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA"
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id local str "featureseqidcasedifference"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        gi 0
      },
      descr {
        molinfo {
          biomol genomic
        }
      },
      inst {
        repr raw,
        mol dna,
        length 100,
        seq-data iupacna "AATTGGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAATT
GGCATGTTAATTGGCCAANNAATTGGCATGTTAATTGGCCAANNAAAA"
      },
      annot {
        {
          data ftable {
            {
              data rna {
                type rRNA,
                ext name "18S small"
              },
              location int {
                from 0,
                to 1,
                strand plus,
                id gi 0
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "GapFeatureProblem"
      },
      descr {
        molinfo {
          biomol genomic
        }
      },
      inst {
        repr delta,
        mol dna,
        length 120,
        ext delta {
          literal {
            length 10,
            seq-data iupacna "CCAANNAAAA"
          },
          literal {
            length 100,
            fuzz lim unk
          },
          literal {
            length 10,
            seq-data iupacna "NNTTGGCCAA"
          }
        }
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "gap"
              },
              location int {
                from 10,
                to 90,
                id local str "GapFeatureProblem"
              },
              qual {
                {
                  qual "estimated_length",
                  val "100"
                }
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 20,
                to 119,
                id local str "GapFeatureProblem"
              },
              qual {
                {
                  qual "estimated_length",
                  val "100"
                }
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 10,
                to 112,
                id local str "GapFeatureProblem"
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 10,
                to 114,
                id local str "GapFeatureProblem"
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 110,
                to 111,
                id local str "GapFeatureProblem"
              }
            },
            {
              data imp {
                key "gap"
              },
              location int {
                from 112,
                to 114,
                id local str "GapFeatureProblem"
              }
            }
          }
        }
      }
    },
    seq {
      id {
        local str "PseudoCdsHasProtXref"
      },
      descr {
        molinfo {
          biomol genomic
        }
      },
      inst {
        repr raw,
        mol dna,
        length 10,
        seq-data iupacna "CCAANNAAAA"
      },
      annot {
        {
          data ftable {
            {
              data cdregion {
              },
              location int {
                from 0,
                to 9,
                id local str "PseudoCdsHasProtXref"
              },
              xref {
                {
                  data prot {
                    name {
                      "prot xref on pseudo cds"
                    }
                  }
                }
              },
              pseudo TRUE
            }
          }
        }
      }
    },
    set {
      class gen-prod-set,
      seq-set {
        seq {
          id {
            local str "ErroneousException_nuc"
          },
          inst {
            repr raw,
            mol dna,
            length 294,
            seq-data iupacna "ATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATG
ACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATC
ATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACA
ATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATG
ACGATTATGTAA"
          },
          annot {
            {
              data ftable {
                {
                  data cdregion {
                  },
                  except TRUE,
                  product whole local str "ErroneousException_prot",
                  location int {
                    from 0,
                    to 293,
                    id local str "ErroneousException_nuc"
                  },
                  except-text "unclassified translation discrepancy"
                },
                {
                  data rna {
                    type mRNA,
                    ext name "mRNA with ErroneousException"
                  },
                  except TRUE,
                  product whole local str "ErroneousException_mrna",
                  location int {
                    from 0,
                    to 293,
                    id local str "ErroneousException_nuc"
                  },
                  except-text "unclassified transcription discrepancy"
                }
              }
            }
          }
        },
        seq {
          id {
            local str "ErroneousException_prot"
          },
          inst {
            repr raw,
            mol aa,
            length 97,
            seq-data iupacaa "MTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTI
MTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIMTIS"
          }
        },
        seq {
          id {
            local str "ErroneousException_mrna"
          },
          descr {
            molinfo {
              biomol mRNA
            }
          },
          inst {
            repr raw,
            mol rna,
            length 294,
            seq-data iupacna "ATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATG
ACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATC
ATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACA
ATAATGACGATTATGACTATTATGACCATCATGACAATAATGACGATTATGACTATTATGACCATCATGACAATAATG
ACGATTAGCTAA"
          }
        }
      }
    },
    seq {
      id {
        local str "WholeLocation"
      },
      inst {
        repr raw,
        mol na,
        length 10,
        seq-data iupacna "ATGTTTAAAC"
      },
      annot {
        {
          data ftable {
            {
              data imp {
                key "misc_feature"
              },
              location whole local str "WholeLocation",
              qual {
                {
                  qual "standard_name",
                  val "Vector Contamination"
                }
              }
            }
          }
        }
      }
    },
    set {
      class nuc-prot,
      seq-set {
        seq {
          id {
            local str "BadProteinName"
          },
          inst {
            repr raw,
            mol na,
            length 10,
            seq-data iupacna "ATGTTTAAAC"
          },
          annot {
            {
              data ftable {
                {
                  data cdregion {
                  },
                  location int {
                    from 0,
                    to 9,
                    id local str "BadProteinName"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            local str "BadProteinName_prot1"
          },
          inst {
            repr raw,
            mol aa,
            length 3,
            seq-data iupacaa "MTIM"
          },
          annot {
            {
              data ftable {
                {
                  data prot {
                    name {
                      "Hypothetical protein"
                    },
                    ec {
                      "1.2.3.4"
                    }
                  },
                  location whole local str "BadProteinName_prot1"
                },
                {
                  data prot {
                    name {
                      "hypothetical protein"
                    },
                    ec {
                      "1.2.3.4"
                    }
                  },
                  location whole local str "BadProteinName_prot1"
                },
                {
                  data prot {
                    name {
                      "Unknown protein"
                    },
                    ec {
                      "1.2.3.4"
                    }
                  },
                  location whole local str "BadProteinName_prot1"
                },
                {
                  data prot {
                    name {
                      "unknown protein"
                    },
                    ec {
                      "1.2.3.4"
                    }
                  },
                  location whole local str "BadProteinName_prot1"
                }
              }
            }
          }
        }
      }
    },
    set {
      class pop-set,
      seq-set {
        seq {
          id {
            local str "SuspiciousFrame1_lcl"
          },
          inst {
            repr delta,
            mol dna,
            length 23,
            ext delta {
              literal {
                length 6,
                seq-data iupacna "AGAACT"
              },
              literal {
                length 3
              },
              literal {
                length 14,
                seq-data iupacna "AGTTGGGCCCCCCT"
              }
            }
          },
          annot {
            {
              data ftable {
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts at end, should be ok",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "Should fail, too close to end to be splice site",
                  location int {
                    from 1,
                    to 5,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "at splice site, should be ok",
                  location int {
                    from 2,
                    to 5,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 3,
                    to 5,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts after gap, should be ok",
                  location int {
                    from 9,
                    to 15,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "at splice site, should be ok",
                  location int {
                    from 11,
                    to 15,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 12,
                    to 15,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts at end, should be ok",
                  location int {
                    from 15,
                    to 22,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, too close to end for splice site",
                  location int {
                    from 15,
                    to 21,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should be ok, starts at splice site",
                  location int {
                    from 15,
                    to 20,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 15,
                    to 19,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts after gap, should be ok",
                  location int {
                    from 0,
                    to 5,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "too close to end for splice site, should fail",
                  location int {
                    from 0,
                    to 4,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should be ok, at splice site",
                  location int {
                    from 0,
                    to 3,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 0,
                    to 2,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl",
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not partial",
                  location int {
                    from 2,
                    to 3,
                    strand minus,
                    id local str "SuspiciousFrame1_lcl"
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not partial",
                  location int {
                    from 2,
                    to 3,
                    strand plus,
                    id local str "SuspiciousFrame1_lcl"
                  }
                }
              }
            }
          }
        },
        seq {
          id {
            other {
              accession "NM_SuspiciousFrame1_lcl"
            }
          },
          inst {
            repr delta,
            mol dna,
            length 23,
            ext delta {
              literal {
                length 6,
                seq-data iupacna "AGAACT"
              },
              literal {
                length 3
              },
              literal {
                length 14,
                seq-data iupacna "AGTTGGGCCCCCCT"
              }
            }
          },
          annot {
            {
              data ftable {
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts at end, should be ok",
                  location int {
                    from 0,
                    to 5,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "Should fail, too close to end to be splice site",
                  location int {
                    from 1,
                    to 5,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "at splice site, should be ok",
                  location int {
                    from 2,
                    to 5,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 3,
                    to 5,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts after gap, should be ok",
                  location int {
                    from 9,
                    to 15,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 10,
                    to 15,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "at splice site, should be ok",
                  location int {
                    from 11,
                    to 15,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 12,
                    to 15,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-from lim lt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts at end, should be ok",
                  location int {
                    from 15,
                    to 22,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, too close to end for splice site",
                  location int {
                    from 15,
                    to 21,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should be ok, starts at splice site",
                  location int {
                    from 15,
                    to 20,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 15,
                    to 19,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "starts after gap, should be ok",
                  location int {
                    from 0,
                    to 5,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "too close to end for splice site, should fail",
                  location int {
                    from 0,
                    to 4,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should be ok, at splice site",
                  location int {
                    from 0,
                    to 3,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not at splice site",
                  location int {
                    from 0,
                    to 2,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    },
                    fuzz-to lim gt
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not partial",
                  location int {
                    from 2,
                    to 3,
                    strand minus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    }
                  }
                },
                {
                  data cdregion {
                    frame two
                  },
                  comment "should fail, not partial",
                  location int {
                    from 2,
                    to 3,
                    strand plus,
                    id other {
                      accession "NM_SuspiciousFrame1_lcl"
                    }
                  }
                }
              }
            }
          }
        }
      }
    }
  }
}